Labshake search
Citations for Takara Bio :
4901 - 4950 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... Then One-step PrimeScript RT-PCR kit (Takara) was used to generate cDNA ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we extracted DNA using NucleoBond HMW DNA (Takara Biotechnology, Japan) and eliminated the short fragments using the Short Read Eliminator Kit (PacBio) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR was performed using TaKaRa PrimeSTAR GXL DNA Polymerase following the manufacturer’s protocol (Takara Biotechnology, Japan). Amplified DNA fragments were purified by illustra ExoProStar (GE Healthcare Life Sciences) ...
-
bioRxiv - Genetics 2023Quote: ... 1.25 U of Ex Taq DNA Polymerase (TaKaRa Bio Inc., Beijing, China) and DNA template - except for the negative (no-template ...
-
bioRxiv - Genetics 2023Quote: ... and their size estimated using a 2000 bp-DNA ladder (TaKaRa Bio Inc., Beijing, China) as a reference and directly sequenced using primers MSP-3 and MSP-4B in separate reactions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and were applied to the SMART RACE kit (Takara Bio USA, Mountain View, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... cloned into the PMD-19T vector (Takara, Japan) and then transformed into TOP10 Escherichia coli competent cells (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of six libraries were generated using the ThruPLEX DNA-seq 6S (12) kit (Takara Bio Europe, TOWN, France). The concentration of each sample pool was measured with Quant-iT PicoGreen dsDNA assay kit (Invitrogen Life Technologies ...
-
bioRxiv - Genetics 2023Quote: ... and used as templates for real-time PCR analysis using SYBR PreMix ExTaqII (Takara). The primers used are listed in Supplementary Table S3 ...
-
bioRxiv - Genetics 2023Quote: ... cDNA was synthesized using the PrimeScript RT reagent kit (Takara) and used as templates for real-time PCR analysis using SYBR PreMix ExTaqII (Takara) ...
-
bioRxiv - Genetics 2023Quote: ... and subjected to quantitative real-time polymerase chain reaction with a TB Green Premix Ex Taq II kit (Takara, RR820A). The PCR program consisted of 95°C for 1 minute ...
-
bioRxiv - Genetics 2023Quote: ... reverse-transcribed into cDNA with a PrimeScript RT Reagent Kit (Takara, RR047A), and subjected to quantitative real-time polymerase chain reaction with a TB Green Premix Ex Taq II kit (Takara ...
-
bioRxiv - Cell Biology 2023Quote: ... MA) and PrimeScript RT reagent kit with gDNA Eraser and SYBR Premix Ex Taq II (Tli RNase H Plus) (TaKaRa, Kusatsu, Japan) (Taniguchi and Yoshida ...
-
Lactylation-driven FTO-mediated m6A modification of CDK2 aggravates diabetic microvascular anomaliesbioRxiv - Cell Biology 2023Quote: ... cDNA was generated using a PrimeScript RT Kit (Takara, Otsu, Shiga, Japan). RNA levels were determined by qPCR with FastStart Universal SYBR Green Master (ROX ...
-
bioRxiv - Cell Biology 2023Quote: was used to carry out reverse transcription (RT) reaction to obtain cDNA following the instruction of PrimeScript RT Reagent Kit (Takara, Japan). RT primers are specific to midRs ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA and specific primers were mixed with a TB Green Premix Ex Taq (Takara, Otsu, Japan). PCR reactions were run on a Smart Cycler System (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Cell Biology 2023Quote: ... TagRFP-CENP-E 2111-C were cloned into the pLVX-IRES-Puro vector (Clontech) by PCR-based Gibson assembly method.
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared from total RNA using the Smarter® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara Bio 634411) and sequenced on a Novaseq 6000 ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... living colours GFP monoclonal antibody (Takara, Cat# 632375) at 1:5000 dilution and anti-ZWF1 antibody (sigma ...
-
bioRxiv - Immunology 2023Quote: ... WBCs were homogenized in RNAiso Plus (Takara Bio Inc.), and the total RNA was isolated ...
-
bioRxiv - Immunology 2023Quote: ... RR420(Takara Bio Inc.), RNeasy MinElute Cleanup Kit (QIAGEN) ...
-
bioRxiv - Immunology 2023Quote: ... with a SYBR Premix Ex Taq II (Tli RNaseH Plus) Kit (Takara Bio Inc.). Specific primers for monkey IL12a ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized from the purified RNA using PrimeScript Reverse Transcriptase with RNase Inhibitor (Takara Bio Inc.), dNTP mixture (Promega Corp. ...
-
bioRxiv - Immunology 2023Quote: ... and 2 µL Smartscribe Reverse Transcriptase (Takara). RNA mixtures were combined with the RT reaction mixture ...
-
bioRxiv - Immunology 2023Quote: ... The RT reaction mixture was prepared on ice and contained (per sample): 4 µL SmartScribe 1st Strand 5X buffer (Takara), 2 µL 100 µM DTT (Takara) ...
-
bioRxiv - Immunology 2023Quote: ... were generated by gene synthesis (Azenta Life Sciences, Burlington, MA) and cloned into NdeI-XhoI-digested pET28a by In-Fusion cloning (Takara Bio USA, Inc., San Jose, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... RNA-seq libraries were generated from 5 ng of RNA with the SMART-Seq v4 Ultra Low Input RNA Kit from Takara Bio (#634889 ...
-
bioRxiv - Microbiology 2023Quote: ... or TALON Metal Affinity Resin (Takara Bio) respectively ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplifications were carried out with PrimeStar polymerase as recommended by the manufacturer (Takara). E ...
-
bioRxiv - Microbiology 2023Quote: ... from pRM1071 was cloned into NcoI-HindIII-digested pHM1552 (Miyazaki et al., 2022) using In-Fusion HD Cloning Kit (Takara bio).
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was cloned into SalI-PstI-digested pKG120 by In-Fusion HD Cloning Kit (Takara bio). The resulting plasmid ...
-
bioRxiv - Microbiology 2023Quote: We first cloned the eGFP sequence between the AvrII and EagI sites of the pEOE-attP vector (53) using In-Fusion cloning (Clontech). KAHRP ...
-
bioRxiv - Microbiology 2023Quote: ... We used mouse anti-GFP (Takara) at 1:1000 dilution ...
-
bioRxiv - Immunology 2023Quote: ... Opposing strand-specific RNA-seq libraries were generated using the SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Cloning was performed with In-Fusion HD methods (Clonteck, Takara Bio Company). pNL1.1-NL is defined as the empty vector (EV) ...
-
bioRxiv - Immunology 2023Quote: ... and sequencing libraries prepared from 10ng RNA using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... DnaJ and GrpE (Takara, 3340). Cells were grown overnight at 37°C on lysogeny broth (LB ...
-
bioRxiv - Neuroscience 2023Quote: ... with 2µg/mL doxycycline (Takara Bio, Cat. No. 631311) to induce expression of NGN2 ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 100 microglia from each region were collected in 5 μL single-cell lysis buffer (635013, Takara), and flash-frozen on dry ice.
-
bioRxiv - Neuroscience 2023Quote: ... was similarly constructed with the leptin receptor promoter controlling expression of mCherry (Clontech) without ChR2 ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T Lenti-X cells (Takara Bio, cat. no. 632180) were maintained in DMEM supplemented with 10% hiFBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Media containing lentiviral particles was collected 72 hours post-transfection and the lentiviral particles were precipitated with 3 volumes of Lenti-X Concentrator (Takara, cat. no. 631232) at 4°C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative RT-PCR was performed using Premix Ex Taq II (Takara Bio Inc., Shiga, Japan) on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (1:1000, Clontech), mAb anti-Bruchpilot (nc82 ...
-
bioRxiv - Microbiology 2023Quote: ... PrimeSTAR Max DNA Polymerase was obtained from TaKaRa. The DNA purification kit was obtained from Axygen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse fibroblast NIH-3T3 (Takara), human retinal pigment epithelial cells (hTERT-RPE1 or RPE1 ...
-
bioRxiv - Genomics 2023Quote: ... oocyte biopsy samples were directly converted to cDNA using the SMART-Seq kit (Takara). A total of eight (n = 8 ...
-
bioRxiv - Genomics 2023Quote: ... RNA (1 ng) was used for cDNA synthesis and amplification using the SMART-Seq HT RNA-Seq library amplification kit (Takara Bio). According to the manufacturer’s recommendations ...