Labshake search
Citations for Takara Bio :
1501 - 1550 of 3733 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: ... and reverse-transcribed by a PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (TAKARA, Japan). qPCR was performed with SYBR Premix Ex Taq™ II (Tli RNaseH Plus ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1000 ng of total RNA were reverse transcribed using the PrimeScript RT-qPCR Kit (TaKaRa, Cat#RR037B). At least four independent biological replicates were collected and analyzed ...
-
bioRxiv - Microbiology 2019Quote: ... Equal volume RNA was reverse transcribed into cDNA using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was first amplified by reverse transcription using the PrimeSCript RT reagent kit (Takara Bio, Inc, Otsu, Japan). Then the relative expressions were measured with TaqMan MicroRNA Assay kit (Applied Biosystems ...
-
bioRxiv - Bioengineering 2021Quote: ... One microgram of RNA was reverse transcribed into cDNA using a PrimeScript™ RT reagent Kit (TaKaRa, RR037A) in a 20 μl reaction ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: cDNA was reverse-transcribed from 1 μg of total RNA using PrimeScript RT reagent (TaKaRa Biotechnology, Shiga, Japan), and 10 ng of cDNA was analyzed using SYBR Premix Ex Taq II (TaKaRa Biotechnology ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription was performed using a PrimeScript™ RT Reagent Kit (Takara Bio, Mountain View, CA 94043 USA). qPCR was performed with gene specific primers and SYBR Green (iTaq Universal SYBR Green Supermix ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time RT-qPCR was performed on the cDNA (Thermal Cycler Dice Real Time System IIMRQ, Takara Bio) using Takara SYBR Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was then reverse transcribed into cDNA by PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio Inc.). Gene mRNA levels were determined using SYBR green dye on Applied Biosystems Q6 Real-Time PCR cycler (Thermo ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... The 2-μg RNA sample was reverse transcribed using the PrimeScript™ RT Master Mix (Takara, Shiga, Japan). Quantitative real-time PCR (qPCR ...
-
bioRxiv - Plant Biology 2021Quote: ... one microgram of DNase-treated RNA was used for reverse transcription using a PrimerScript RT reagent kit (Takara) and a mix of oligo poli-dT and random hexamers ...
-
bioRxiv - Cancer Biology 2021Quote: ... lncRNA NEAT1 and MMP2 mRNA were reversed transcribed into cDNA using PrimeScript RT Reagent Kit (Takara, Dalian, China), and miR-1299 was reversed transcribed into cDNA using TaqMan microRNA Reverse Transcription Kit (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... 500 ng of total RNA was used in 10 μL PrimeScript™ RT Master Mix (TaKaRa, Tokyo, Japan) as described in the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated from 110 ng of total RNA using the PrimeScript™ RT reagent Kit (Takara, Japan) with a combination of both oligo-dT and random hexamers following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated from 110 ng of total RNA using the PrimeScript™ RT reagent Kit (Takara, Japan) with a combination of both oligo-dT and random hexamers following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... and was reverse transcribed using a PrimeScript ® RT reagent kit with gDNA Eraser (RR047A; TaKaRa, Dalian, China). qRT-PCR was performed with SYBR Green master mix (DRR420A ...
-
bioRxiv - Biochemistry 2022Quote: ... Five hundred nanogram of total RNA was reverse transcribed by PrimeScript RT reagent kit with gDNA eraser (Takara), and qRT-PCR was performed using KAPA SYBR FAST Master Mix (2X ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 ng of total RNA was reverse transcribed into cDNA using PrimeScript™ RT Master Mix (Takara, RR036A). qPCR analyses were performed using SYBR Premix Ex Taq™ II (Takara ...
-
bioRxiv - Microbiology 2022Quote: ... Complementary DNA (cDNA) was synthesized using the PrimeScript RT reagent kit (Perfect Real Time Kit, Takara Biochemicals, China). According to the vendor’s instructions ...
-
bioRxiv - Microbiology 2022Quote: cDNA was synthesized from total RNA or immunoprecipitated RNA using PrimeScript RT reagent Kit with gDNA Eraser (Takara). RT-qPCR analysis was performed using TB Green Fast qPCR Mix (Takara ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 uL Maxima 5x RT buffer, 0.124 uL NxGen RNAse inhibitor, 0.25 uL SUPERase In, 1 uL 10 mM Takara dNTPs ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was reverse-transcribed using a PrimeScript RT reagent Kit with gDNA Eraser (Cat: RR047A, TAKARA, Shiga, Japan), and qPCR was performed on a Bio-Rad CFX96 machine (Hercules ...
-
bioRxiv - Cancer Biology 2022Quote: ... USA).and converted to cDNA using a Primescript RT reagent kit (Cat# RR037A, DSS Takara Bio India Private Ltd) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... each RT reaction solution was amplified in 25 µl of SYBR Premix Ex Taq II (Takara Bio, Inc.) containing 0.2 µM of each primer ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR was performed using TB Green® Premix Ex Taq™ (Tli RNase H Plus) (Takara, RR420B) according to manufacturer’s instructions on an Applied biosystems StepOnePlus machine ...
-
bioRxiv - Pathology 2023Quote: ... Reverse RNA transcription was performed using the PrimeScript RT Reagent Kit with gDNA Eraser (RR047A; Takara Bio, Japan). A 10 μL reaction mix was formulated as follows ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA (0.5 μg) was reverse transcribed by the PrimeScript RT reagent kit with genomic DNA Eraser (Takara, USA) using random and oligo-dT primer mix in a 10 μL reaction ...
-
bioRxiv - Genetics 2023Quote: ... The RNA was reverse-transcribed into cDNA by using a Prime ScriptTM RT Reagent Kit (TaKaRa, Kyoto, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 400 ng of RNA was used to prepare cDNA using Primescript RT Master Mix (Clontech) at 42 °C following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and first-strand cDNA was synthesized using PrimeScript RT Master Mix (Perfect Real Time) (RR036Q; TaKaRa, Ohtsu, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cDNAs was synthesized from total RNA using the PrimeScript™ RT Master Mix (Perfect Real Time, Takara). Quantitative real-time PCR was performed in triplicate using PowerUp SYBR Green (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... One µg of total RNA was processed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Beijing, China). Amplified products were sequenced and verified after cloning into a pJET1.2-T vector through CloneJET PCR Cloning Kit (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription was performed to make cDNA using PrimeScript RT reagent kit with gDNA Eraser (TaKaRa, Kyoto, Japan). Sequences encoding the C-terminal portion (amino acid 45 to 131 ...
-
bioRxiv - Biophysics 2023Quote: ... The first-strand cDNA was reverse transcribed with PrimeScript™ RT Reagent Kit with gDNA Eraser (TaKaRa, Japan). Quantitative real-time PCR was run on a Roche LightCycler® 480 II real-time PCR detection system ...
-
bioRxiv - Plant Biology 2024Quote: ... The resulting samples were reverse transcribed into first-strand cDNA using a PrimeScript RT Reagent Kit (Takara Bio). Quantitative PCR (qPCR ...
-
bioRxiv - Zoology 2024Quote: ... One µg of total RNA was processed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Beijing, China). The PCR procedure was set as follows ...
-
MALAT1 mediates miR-206/CDC42/PAK1/Paxillin signaling axis to alleviate erectile dysfunction in ratsbioRxiv - Molecular Biology 2024Quote: ... And the obtained RNA was used for reverse transcription using the PrimeScript RT Enzyme Mix I kit (TaKaRa). After the reaction was completed ...
-
bioRxiv - Neuroscience 2024Quote: ... RT-qPCR was performed using SYBR® Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc.). SYBR green detection of PCR products was conducted in real time using a MyiQ single-color detection system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative assessment of relative RNA expression was performed via RT-qPCR using SYBR Premix Ex TaqTM (TaKaRa, Japan). The reference gene ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated with Trizol (Thermo) and cDNA was synthesized with Prime Script RT Reagent Kit (Takara). Quantitative PCR was performed with a SYBR Green PCR kit (Toyobo ...
-
bioRxiv - Cell Biology 2023Quote: cDNA was synthesized from the total RNA of HapT1 cells using the PrimeScript RT Reagent Kit (Takara Bio). The amounts of Pts and Actb were quantified on a LightCycler 480 (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... Complementary DNA (cDNA) was synthesized using the PrimeScript™ RT reagent Kit with gDNA Eraser Kit (TaKaRa, Japan) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara). The reactions were carried out as follows ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg total RNA was used for cDNA synthesis by oligo(dT)18 primer according to the manufacturer’s protocol (Takara). The resulting cDNA was subjected to relative quantitative PCR using the ChamQ™ SYBR qPCR Master Mix (Vazyme Biotech Co.,Ltd ...
-
bioRxiv - Microbiology 2021Quote: ... Thirty-five cycles of L reaction with 0.4 mM barcoded TprK forward and reverse primers (S1 Table) using the 2x CloneAmp MasterMix (Takara) with a 62°C annealing temperature ...
-
bioRxiv - Plant Biology 2019Quote: The 5’ ends of the viral genomes sequences were determined or confirmed using the 5’ Rapid Amplification of cDNA Ends (RACE) strategy and internal primers designed from the genomic contigs (Table S1) following the kit supplier’s recommendations (Takara Bio Europe/Clontech ...
-
bioRxiv - Cell Biology 2019Quote: ... For lentiviral transduction WT and Quad-K Jam-C-GFPout were amplified using appropriate primers (Supp. Table 1) and subcloned into pSFFV-WPRE using an infusion reaction according to the manufacturer’s instructions (Clontech).
-
bioRxiv - Molecular Biology 2019Quote: ... and the DNA fragments around the target sequences were amplified with the following primers using PrimeSTAR Max (TaKaRa, Japan).
-
bioRxiv - Genomics 2019Quote: Primers were designed to amplify 16.1kb of the mitochondrial genome and LA Taq Hot Start polymerase (TaKaRa Bio, Japan) was used to generate LR-PCR products ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...