Labshake search
Citations for Takara Bio :
1751 - 1800 of 3947 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Each RNA sample was reverse-transcribed to cDNA after DNase I treatment using a PrimeScript RT reagent kit (Takara). PCR was performed as described in Kumar et al ...
-
bioRxiv - Cell Biology 2021Quote: ... An equal amount of RNA for each sample was converted to cDNA using PrimescriptTM RT Reagent Kit (Takara Bio), or Superscript IV (Thermofisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription (RT) was then initiated with the cDNA synthesis kit (PrimeScript™ 1st strand cDNA Synthesis Kit; Takara) using the random hexamers option ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was converted to cDNA with the PrimeScript™ RT reagent Kit Prime Script TMRT reagent Kit (Takara, Japan), and the cDNA was analyzed by qRT-PCR using TB Green® Premix Ex TaqTM II (Takara ...
-
bioRxiv - Genetics 2022Quote: ... 1 µg of total RNA was used for reverse transcription using PrimeScript RT Reagent Kit (Cat#RR037A, TaKaRa, Japan). Quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Biochemistry 2022Quote: One μg of RNA per kidney half was reverse-transcribed using PrimeScript RT Reagent kit (RR037 TAKARA, Shiga, Japan). Two μl of cDNA was used for quantitative real-time PCR to assess gene mRNA expression ...
-
bioRxiv - Immunology 2020Quote: ... and 250 ng RNA of each sample was reverse transcribed to cDNA using the Primescript RT kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized at 44°C for 15 min using the PrimeScript RT reagent kit with gDNA eraser (TaKaRa) and a y300 PAT universal C10 primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... One microgram of total RNA was reverse transcribed by the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, RR047A). Quantitative PCR was performed in technical duplicates with FastStart Essential DNA Green Master Mix (Roche ...
-
bioRxiv - Plant Biology 2021Quote: Total RNAs were extracted using TRIzol reagent and reverse-transcribed into cDNAs using the PrimeScript RT reagent kit (TaKaRa). RT-qPCR was performed using KAPA SYBR FAST qPCR master mix (Kapa Biosystems ...
-
bioRxiv - Pathology 2021Quote: ... Complementary DNA was synthesized using the PrimeScript™ RT reagent Kit supplemented with a gDNA Eraser (TaKaRa, Dalian, China) and random primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... The cDNA was synthesized with 1 ug total RNA using the PrimeScriptTM RT Reagent Kit with gDNA Eraser (TaKaRa). qRT-PCR was performed using a qTOWER3G system (analytikjena ...
-
bioRxiv - Cell Biology 2020Quote: ... The complementary DNA (cDNA) was synthesis via reverse transcription reaction using a PrimeScript RT reagent kit (Takara, South Korea) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA (1 mg) was reverse transcribed using the PrimeScript RT Reagent Kit with the gDNA Eraser (TAKARA, Japan). Quantitative PCR reactions were performed using the gene-specific primers of FLC and FT (Table S1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was isolated as described above and reverse transcribed into cDNA with the prime Script RT reagent kit (Takara). 10 ng of cDNA was used in a 1X reaction consisting of 12.5 µl TB Green Premix Ex Taq II (Tli RNaseH plus ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Cell Biology 2022Quote: ... Complementary DNA (cDNA) was prepared from 1 μg of RNA using PrimeScriptTM RT Master Mix (catalog no. RR036A, Takara). qPCR was performed using TB Green Premix Ex TaqTM (catalog no ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA synthesis from at least three biological replicates was performed using the PrimeScript™ RT Master Mix (TaKaRa, #RR036A) and real-time PCR was performed using SYBR Green I Master (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized from 500 ng total RNA using a Prime Script RT Reagent Kit (Takara Bio, Otsu, Japan). RT- PCR was performed using three primer sets ...
-
bioRxiv - Microbiology 2022Quote: ... an equal quantity of total RNA (500 ng) was used in reverse transcription (RT) using PrimeScript RTase (Takara Bio). PCR was performed using GoTaq® Green (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Physiology 2022Quote: ... Total RNA from each sample was extracted and reverse-transcribed to cDNA with PrimeScript RT reagent kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... Total RNA from each sample was extracted and reverse-transcribed to cDNA with PrimeScript RT reagent kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... cDNAs synthesized from the extracted total RNAs using a PrimeScript™ RT reagent Kit with gDNA Eraser (TAKARA, Japan) were used as templates to perform qPCR assays for the checking of the transcriptions of VEGFA ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized at 44°C for 15 min using the PrimeScript RT reagent kit with gDNA eraser (TaKaRa) and the y300 PAT universal C10 primer ...
-
bioRxiv - Developmental Biology 2024Quote: ... 500 ng of RNA template was subjected to in vitro reverse transcription using PrimeScript RT Reagent Kit (Takara, RR037). After elution with 40 ul of DNase/RNAse free water ...
-
bioRxiv - Genetics 2024Quote: ... purified by phenol chloroform extraction and then reverse transcribed with a PrimeScript™ RT Reagent Kit (TAKARA, Dalian, China) according to the manufacturers’ protocol.
-
bioRxiv - Plant Biology 2024Quote: ... First-strand complementary DNA (cDNA) was synthesized using a PrimeScript RT reagent kit with gDNA Eraser (TaKaRa, Dalian, China). SYBR Premix ExTaqTM (TaKaRa ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cDNA was synthesized by reverse transcription using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 0.3 mg of total RNA was converted into cDNA with the PrimeScript RT Reagent Kit (Takara, Japan, RR037A) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized from 1 µg of each RNA sample using PrimeScript RT Reagent Kit with gDNA Eraser (Takara), and the primers used for qRT-PCR were designed using Primer3web ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 ng of each RNA sample was reverse-transcribed with PrimeScript RT Master Mix (Perfect Real Time) (Takara Bio). qPCR was performed using the QuantiTect SYBR Green PCR Kit (QIAGEN) ...
-
bioRxiv - Bioengineering 2024Quote: ... and reverse-transcribed into cDNA using PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara Bio). The resulting cDNA was utilized for analysis using TB Green® Premix Ex Taq™ II (Tli RNaseH Plus ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cDNA synthesis and gDNA erase protocol were performed using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). Quantitative real-time RT-PCR (qRT-PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription of RNA into cDNA was accomplished with the PrimeScript RT reagent Kit with gDNA Eraser (RR047A, Takara), followed by quantitative RT-PCR (qRT–qPCR ...
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 ug of RNA was reverse-transcribed into cDNAs using the Prime Script RT Reagent Kit (Takara, RR037B) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR detection was performed on each group of samples by using a reverse transcription kit (Takara Bio, Japan) and fluorescence quantitative kit (Takara Bio ...
-
bioRxiv - Genomics 2023Quote: 200ng of RNA extracted from whole human blood used as input for reverse transcription using Smartscribe RT (Takara Clontech) with primers targeting the IGH constant regions (IDT ...
-
bioRxiv - Genomics 2023Quote: 200ng of RNA extracted from whole human blood used as input for reverse transcription using Smartscribe RT (Takara Clontech) with primers targeting the IGH constant regions (IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... The same amount of total RNAs from each sample were reversely transcribed with PrimeScript RT Master Mix (TaKaRa, RR036A). Diluted cDNAs were mixed with primers and SsoAdvanced Universal SYBR® Green Supermix (BioRad ...
-
bioRxiv - Microbiology 2023Quote: ... and an aliquot of 100 ng was reverse transcribed with the PrimeScript RT Reagent Kit with gDNA Eraser (Takara) and the included primer mix ...
-
bioRxiv - Microbiology 2022Quote: ... Isolated RNA or serial ten-fold dilutions of RNA standards for the ORF1ab amplicon (ranging from 2.25×10^6 to 250 copies/rxn) were reverse transcribed using the Takara Prime Script RT kit (Takara) using poly(A ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA was prepared from 1 µg of total RNA using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara). Real-time polymerase chain reaction (real-time PCR ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 300 ng was used as template for the reverse transcription using the PrimeScriptTM RT Master mix (#RR036A, Takara, France). The qPCR was performed with a QuantStudio 6 Flex system equipped with a 384-well block and the SspAdvanced Unversal SYBR® Green Supermix (#1725272 ...
-
Multi-omics analysis reveals signatures of selection and loci associated with complex traits in pigsbioRxiv - Genomics 2023Quote: ... and then reverse-transcribed to cDNA using the PrimeScript™ RT Master Mix (Perfect Real Time) (Takara, Beijing, China) according to the manufacturer’s protocols ...
-
bioRxiv - Genomics 2023Quote: Five µg of each Quartet RNA sample was reverse transcribed using the PrimeScript™ RT reagent Kit (RR037A, TaKaRa) in a 50 µl reaction ...
-
bioRxiv - Immunology 2024Quote: ... 500 ng of total RNA was used for synthesis of cDNA using PrimeScriptTM RT reagent Kit (Takara, Tokyo, Japan). For miRNA expression analysis ...
-
bioRxiv - Molecular Biology 2024Quote: ... and subjected to RT with the use of a TaKaRa PrimeScript II 1st Stand cDNA Synthesis Kit (Takara Bio). The resulting cDNA was subjected to real-time PCR analysis with Fast SYBR Green Master Mix (3485612 ...
-
Aromatase in adipose tissue exerts an osteoprotective function in male mice via phosphate regulationbioRxiv - Physiology 2024Quote: ... or ISOGEN (319-90211, NIPPON GENE) and synthesized into cDNA using PrimeScript RT Master Mix (RR036, Takara Bio Inc.). RT-qPCR was performed using cDNA to evaluate gene expression with Thermal Cycler Dice (Takara Bio ...