Labshake search
Citations for Takara Bio :
1701 - 1750 of 3733 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′ -GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2020Quote: ... we first used primers with overhangs harboring SfiI sites to amplify the IRES-DsRed-Express from pIRES2-DsRed-Express (Clontech). This fragment was then cloned into the NruI site in pUC57-GentR via cut-ligation to generate an intermediate cloning vector pUC57-SfiI-IRES-DsRed-Express-SfiI ...
-
bioRxiv - Microbiology 2021Quote: ... were PCR-amplified from genomic DNA with primers 19-22 and cloned into the vector pRS29 using ligation-independent cloning (In-Fusion, Clontech). A guide RNA with sequence AATAACGATATTAAATGTAA was cloned into a modified pAIO vector called pCasG85 using primers 23 and 24 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... then removed from the pGEM shuttle plasmid using EcoRI and NotI enzymes and annealed into the DFRS empty plasmid pre-amplified (DFRS empty plasmid primers) and digested by the same enzymes (In-Fusion Kit; Clontech). The control cassette was thus placed on the 3’UTR of the RFP gene.
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
bioRxiv - Plant Biology 2020Quote: ... The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196) and Atcox1-3’(+17..+38) using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4 minute-denaturation at 95°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and reverse-transcribed with T7-oligo(dT)24 as a primer using the PrimeScript II 1st strand cDNA Synthesis kit (TaKaRa). Then the poly(A ...
-
bioRxiv - Plant Biology 2021Quote: ... and HBS1-R (BamHI)] and HBS1 [using primers HBS1-2-F (NdeI) and HBS1-2-R (BamHI)] were amplified and subcloned into pGADT7 vectors (Clontech). Bait and prey plasmids were co-transformed into the yeast strain AH109 according to the manufacture’s introduction (Clontech) ...
-
bioRxiv - Plant Biology 2021Quote: ... The EVD coding sequence (At5TE20395) was directly amplified from wt Col DNA using primers containing appropriate plasmid homology for In-Fusion Cloning (Clontech) into their respective digested binary vector backbones ...
-
bioRxiv - Microbiology 2019Quote: ... We conducted PCR across the gapped regions between the de novo assembled contigs with the primers described in S1 Table using the high-fidelity PrimeSTAR GXL DNA polymerase (Takara). The following PCR conditions were used ...
-
bioRxiv - Cell Biology 2020Quote: ... was amplified using ESRG-S and ESRG-AS primers and inserted into the BamHI/NotI site of a pMXs retroviral vector [39] using In-Fusion technology (Clontech). The primer sequences for the cloning are available in S1 Table.
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Plant Biology 2022Quote: ... phyllopogon (line 511) using primers listed in Table S1 with KOD FX Neo (TOYOBO) or PrimeSTAR GXL DNA Polymerase (Takara). The amplicons were subcloned using pGEM-T Easy Vector Systems Kit (Promega ...
-
bioRxiv - Biophysics 2022Quote: ... with insertion of N-terminal residues MATLEK a part of the N17 domain and C-terminal residues PQAQPLLPQPQPPPPPPPPPPGPAVAEEPLHRP which comprise the PR (proline-rich) domain containing the C38 domain using primers as a part of In-Fusion cloning protocol (Takara). eGFP-PolyQ31 was adapted from eGFP-PolyQ74 through the variability of Q-length PCR products amplified using CloneAmp HiFi PCR Premix (Takara) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the MS2 binding sites were amplified with primer pair 1 (Supplementary File 1: Table S4) and cloned into pEGFP-C1 (Clontech) as EcoRI/BamHI fragment ...
-
bioRxiv - Plant Biology 2021Quote: ... the CDS of SWEET5 was amplified by primers P17 and P18 and subcloned into it by In-Fusion® (Takara). The agroinfiltration-based assays were performed as previously described (Gookin and Assmann ...
-
bioRxiv - Plant Biology 2021Quote: ... and USP by their own specific primers (P9-P14) were seamlessly subcloned into corresponding pGTKan3_promoter constructs by In-Fusion® (Takara) following the linearization at XbaI and PstI restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... overhangs (see table for primer sequences) and fused in frame at its carboxyl end via GA to eGFP in the vector eGFP-N3 (CLONTECH), to generate flZEB1-GFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... were generated from pEGFP-C3 K19 WT using the primers listed in Table 1 with the In-Fusion HD cloning system (Takara). GFP and GFP-tagged K19 WT and mutantconstructs were cloned from pEGFP-C3 K19 constructs into pLenti CMV Hygro (plasmid #17484 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1999)) along with the primers listed in Table 1 and the In-Fusion HD cloning system (Takara, Mountain View, CA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the RNA was concentrated and reverse transcribed with a 5’-RACE protocol that appends a new primer site to the cDNA of both cleaved and uncleaved RNA (SMARTScribe, Takara). The cDNA was PCR amplified with primers that add the adaptors for Illumina sequencing ...
-
bioRxiv - Zoology 2020Quote: ... followed by the synthesis of cDNA with reverse transcriptase and oligo-dT primers according to the manufacturer’s instructions (TaKaRa, Japan). The 2−ΔΔCt method was used to evaluate the quantitative variation ...
-
bioRxiv - Plant Biology 2020Quote: ... Total amount of 1 μg RNA was used as template for first-strand cDNA synthesis with the oligo(dT) primer and the PrimeScriptTMRT reagent Kit with gDNA Eraser (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Neuroscience 2019Quote: ... 20μl cDNA solution per hemibrain was synthesised from 4-5g RNA using RNA-to-cDNA EcoDry Premix with random primers (Clontech), and was diluted 50-fold with distilled water.
-
bioRxiv - Microbiology 2021Quote: ... and NCIMB8826R using the pts1BCA_trunF (5’-TCGTCACCGAGTGTTCGTTT) and pts1BCA_trunR (5’-AGTTGCTGGCCACTGTTCAT) primers (Table S8) and ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... and complementary primer pairs (sequences available on request) was used to generate TMEM127 variants in the pEGFP-C2 (Clontech Laboratories) and pCMV6-XL5 (Origene ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed on 2 μg of total RNA using the Primescript Reverse Transcription Kit with a mixture of oligo-dT primers and random hexamers (Takara) after TURBO™ DNase (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... This allowed the HA tags to be replaced with GFP (amplified with primers including the AatII sites from pEGFP-N1 (Clontech). Forward primer ...
-
bioRxiv - Genetics 2020Quote: ... Three overlapping MTM1 cDNAs were amplified using three pairs of cDNA primers from Tosch et al(Tosch et al. 2010) using the PrimeSTAR GxL kit (Takara). Primers are F1/R1 (ATGGCTTCTGCATCAACTTC / TGGAATTCGATTTCGGGAC ...
-
bioRxiv - Microbiology 2021Quote: ... The parasite load in the livers and HepG2 cells was evaluated by Taqman-PCR with primers and probes for 18S rRNA and GAPDH following the manufacturer’s instructions of Premix Ex Taq™ (Probe qPCR) (TAKARA). For the SYBR quantitative PCR assay ...
-
bioRxiv - Microbiology 2020Quote: ... The double-stranded oligonucleotides were end-labeled with [α-32P]-dCTP with the Random Primer Labeling Kit (Takara, Dalian, China). The binding reaction (28 μl ...
-
bioRxiv - Cell Biology 2022Quote: We used the In-Fusion™ (IF) HD cloning system online primer design website (Takara Bio USA, Mountain View, CA) to create primer sets (Table S1 ...
-
bioRxiv - Cell Biology 2022Quote: ... a polymerase chain reaction using 5’-TCTAGAGCTACTAACTTCAGCCTGCTG-3’ / 5’ - CGGTGGATCCCCTTCTTCC-3’ primers on Ibidi USA 60101 LifeAct-GFPtag2 plasmid was cloned with In-Fusion HD enzyme kit (Takara) into the pLVX vector (Clontech ...
-
bioRxiv - Plant Biology 2022Quote: The genomic sequence corresponding to the BnaAnng22030D gene and its surroundings was amplified using specific primers (Supplemental Table S1) and PrimeSTAR GXL DNA Polymerase (Takara). The PCR product was cloned and sequenced ...
-
bioRxiv - Molecular Biology 2023Quote: ... wild-type ORF was amplified using point mutated primers and cloned into pCS2+ via XhoI/XbaI restriction sites using DNA Ligation Kit (TAKARA). The ORFs of zebrafish etf1b (ENSDARG00000043976 ...
-
bioRxiv - Systems Biology 2023Quote: ... RORC reporter locus was then amplified with a custom primer (ACACTCTTTCCCTACACGACGCTCTTCCGATCT TGGGGTGATCCAAATACCACC) and sequencing libraries were then prepared with SeqAmp DNA Polymerase (Takara). Libraries were then sequenced on an illumina Hiseq 4000 sequencer.
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was performed using first-strand cDNA and a primer pair designed for target genes using the SYBR Premix Ex Taq Perfect Real Time Kit Tli RNAaseH Plus (TAKARA) and Thermal Cycler Dice Real Time System (Model TP800 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Microbiology 2023Quote: ... Subsequently the 1086 bp downstream of the pv6 gene was amplified using primers CVO675 and CVO676 and introduced into pBLD701 at the AflII site using InFusion (Takara), producing pBLD702 ...
-
bioRxiv - Cell Biology 2023Quote: ... Single-stranded cDNA was reverse transcribed from 500ng total RNA using reverse transcriptase and oligo(dT) primer (Takara, Catalog#RR036). Real-time qPCR amplification was performed using the PrimeScript™ RT-PCR Kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA using the indicated primers (Table S1).Fluorescent reporters were ordered as gBlocks and cloned using the In-fusion HD EcoDry Cloning kit (Takara). Promoter reporter constructs were created as previously described (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A repair plasmid to replace the coding sequence of SOS1 with an HXGPRT-mCherry construct was generated by amplifying the 5’ and 3’ UTRs of SOS1 (adjacent to the protospacers in the Cas9-sgRNA plasmid) using primers 81-84 and inserting the resulting fragments into the pTKO2 plasmid27 by In-Fusion cloning (Takara). Parasites were co-transfected with both the Cas9-sgRNA and pTKO2 plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was synthesized with the PrimeScript 1st Strand kit with an additional primer mix containing random DTs (#RR047A and #6110A, Takara). cDNAs were amplified using specific Taqman probes ...
-
bioRxiv - Molecular Biology 2023Quote: ... and axis sites (YBP1, GRR1) (see qPCR Primer Table) using the TB Green Premix Ex Taq II (Tli RNAse H Plus, Takara).
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR for pluripotency and trilineage spontaneous differentiation was performed according to the instruction manual of the human ES cell Primer Array (Takara Clontech).
-
bioRxiv - Microbiology 2023Quote: ... and the internal control feline peptidyl prolyl isomerase A (PPIA) was amplified using primers Fe-227S and Fe-204R via SYBR Premix Ex Taq II (Tli RNaseH Plus; Takara). Thermal cycling was performed according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... and were reverse transcribed to first-strand cDNAs with random primers using PrimeScript First Strand cDNA Synthesis Kit (Takara, Japan). Quantitative PCR (qPCR ...