Labshake search
Citations for Takara Bio :
801 - 850 of 1523 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... RORC reporter locus was then amplified with a custom primer (ACACTCTTTCCCTACACGACGCTCTTCCGATCT TGGGGTGATCCAAATACCACC) and sequencing libraries were then prepared with SeqAmp DNA Polymerase (Takara). Libraries were then sequenced on an illumina Hiseq 4000 sequencer.
-
bioRxiv - Genetics 2023Quote: ... The whole fkbA locus from the FK506 resistant isolates was amplified using primers JOHE52223 and JOHE52224 and LA Taq DNA polymerase for long-range PCR with GC Buffer I (Takara). PCR conditions were optimized for long fragments as follows ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA using the indicated primers (Table S1).Fluorescent reporters were ordered as gBlocks and cloned using the In-fusion HD EcoDry Cloning kit (Takara). Promoter reporter constructs were created as previously described (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A repair plasmid to replace the coding sequence of SOS1 with an HXGPRT-mCherry construct was generated by amplifying the 5’ and 3’ UTRs of SOS1 (adjacent to the protospacers in the Cas9-sgRNA plasmid) using primers 81-84 and inserting the resulting fragments into the pTKO2 plasmid27 by In-Fusion cloning (Takara). Parasites were co-transfected with both the Cas9-sgRNA and pTKO2 plasmids ...
-
bioRxiv - Plant Biology 2024Quote: ... gene-specific primers adding a His-tag sequence were used with the In-Fusion® HD EcoDry™ kit (Takara). The complementation construct containing A ...
-
bioRxiv - Microbiology 2024Quote: ... The expression profile of target gene was evaluated using specific primers (Table-S2) by using SYBR green RT-PCR master mix (Takara) in Applied Biosystems (Quantstudio 5 ...
-
bioRxiv - Microbiology 2024Quote: ... KanMX was amplified from the plasmid pUG6A with designed primers with the INO2 sequences (Additional information, Table S1) using PCR with Ex Taq Polymerase (Takara). We used the plasmid pRCC_N-Ino2 ...
-
bioRxiv - Microbiology 2024Quote: ... and about 1kb downstream of lctO was amplified with primers (BHN97 LctO down F spect-GAAAACAATAAACCCTTGCATATGTAAAACAGATTGCCTCCACTGAATG and BHN97 LctO down R-GCGACTGCTTGATTCCAGC) using PrimeStar High Fidelity Polymerase (Takara). PCR products were gel extracted (Qiagen MinElute ...
-
bioRxiv - Immunology 2024Quote: ... PCR amplification was performed with primers flanking the gRNA target sites (forward: AGACAAGTGCACAGTGAAGCCA; reverse: TCCGCCACCAACCTATGTCTTTC) using TITANIUM Taq DNA Polymerase (Takara). The knockout was further confirmed by Sanger sequencing using a primer upstream of the gRNA sites (TCCCAGAACTGGAGTGGT ...
-
bioRxiv - Plant Biology 2024Quote: ... The coding region of S-HsfA4c lacking the stop codon TAG was amplified from cDNA using the primers S-HsfA4c-GFP-F/-R and cloned and inserted into the BglII/SpeI sites of pCAMBIA1302 (Clontech) to generate 35S:S-HsfA4c-GFP ...
-
bioRxiv - Plant Biology 2024Quote: ... The coding region of S-HsfA2 lacking the stop codon TAG was amplified from genomic DNA using the primers S-HsfA2-GFP-F/-R and cloned and inserted into the NcoI/SpeI sites of pCAMBIA1302 (Clontech) to generate 35S:S-HsfA2-GFP.
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 LR cells) were individually re-amplified using the 5’ PCR Primer II A with CloneAmp HiFi PCR Premix (Clontech Laboratories ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized from RNA (approximately 2 μg) with oligo(dT) primers according to the instructions of the PrimeScript First Strand cDNA Synthesis Kit (Takara).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... using gene-specific oligonucleotide primers encompassing AsiSI and MluI restriction sites (Table 1) and Advantage Polymerase mix (Takara Bio, USA). The AsiSI-MluI-digested rTRPV1 DNA fragment was ligated into the pcDNA™5/FRT/TO plasmid (Invitrogen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... with ‘KO’-primers introducing 50 bp overhangs with homology to the respective target locus using PrimeStar GXL polymerase (Takara Bio). These ‘KO’-primers were designed following the KEIO knockout collection homology arms sequences (Baba et al. ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Immunology 2021Quote: ... was used to for two-step qPCR assay after cDNA synthesis using PrimeScript® reverse transcriptase kit (Takara, Japan). Gene expression was normalized to the expression level of β-actin ...
-
bioRxiv - Developmental Biology 2021Quote: ... RT-qPCR was performed on three biological replicates using an ABI StepOne PCR detection system with SYBR Green (Takara). GmUbiquitin (SUBI-2.2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and qPCR reactions were conducted in 20 μL of a mixture containing 1x TB Green premix Ex TaqII (Takara), 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara) ...
-
bioRxiv - Genetics 2020Quote: ... and the DNA solution (0.2 ng) was applied to qPCR using SYBR Premis Ex TaqTM (Tli RHaseH Plus) (RR420A; TAKARA). For normalization ...
-
bioRxiv - Genetics 2020Quote: ... into a 96-well plate with qPCR buffer [SYBR Premis Ex TaqTM (Tli RHaseH Plus)] (RR420A; TAKARA, Tokyo, Japan) with 0.4 uM primers (Table S2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR (qPCR) was conducted using TB GreenTM Premix Ex TaqTM (Tli RNaseH Plus) according to the manufacturer’s protocol (Takara). The primers used for qPCR were 5’-ACCATTGTGGACACACCAGG-3’ and 5’-GAACCTGTGACCACCTGCTA-3’ for human ARTS ...
-
bioRxiv - Microbiology 2020Quote: ... SYBR Green-based RT-qPCR were used according to the manuals by SYBR Premix Ex Taq kit (Takara Bio). Primers used in RT-qPCR reactions as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNA was assayed with ReverTra Ace qPCR Master Mix (TOYOBO, FSQ-201) in a Thermal Cycler Dice (TaKaRa) with TB Green Premix Ex Taq II (Tli RNaseH Plus ...
-
bioRxiv - Genomics 2021Quote: ... The molar concentration of the library was determined by quantitative PCR (qPCR) using Library Quantification kit (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was subsequently used for real-time qPCR using TB Green Premix Ex Taq (Tli RNase H Plus) (Takara). Viral RNA from nasal washes was also used for whole viral genome sequencing ...
-
bioRxiv - Evolutionary Biology 2020Quote: The water-in-oil droplets after the incubation step were diluted 10000-fold with 1 mM EDTA (pH 8.0) and subjected to RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with primer 1 and 2 after heating at 95 °C for 5 min ...
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR detection was performed on each group of samples by using a reverse transcription kit (Takara Bio, Japan) and fluorescence quantitative kit (Takara Bio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse-transcription-quantitative PCR (RT-qPCR) was conducted using the Mir-X miRNA qRT-PCR TB Green Kit (TAKARA), the reverse-transcription samples ...
-
bioRxiv - Microbiology 2024Quote: ... M-MLV reverse transcriptase (2641A) and TB Green® Fast qPCR Mix (RR430A) were purchased from Takara (Tokyo, Japan).
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNA was reverse transcribed and applied for PCR/qPCR analysis with PrimeScript™ reverse transcriptase (2680B, Takara, Japan). As an internal control for normalization ...
-
bioRxiv - Microbiology 2022Quote: ... Viral load was measured by RT-qPCR using One-Step SYBR® Primescript(tm) RT-PCR kit II (Takara). CT values from serum samples were used to calculate serum viral load according to regression equation built by a set of standard viral RNA extracted from dilutions of known titre virus preparation ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative PCR (qPCR) was conducted in technical duplicate samples utilizing TB Green Premix Ex Taq II (Takara, Cat# RR820S) and the Thermal Cycler Dice (Takara ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ligated RNA was then subjected to TaqMan qPCR using the One Step PrimeScript RT-PCR Kit (Takara Bio), with 200 nM of a TaqMan probe targeting the boundary of the target RNA and the 3′-AD ...
-
bioRxiv - Physiology 2024Quote: ... Using a Bio-rad Mx3000P qPCR system and SYBR Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa Biotech. Co.), qRT-PCR analyses were carried out ...
-
bioRxiv - Neuroscience 2024Quote: ... Gene expression was analyzed by qPCR with TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (Takara Bio). The PCR primers used in this study are listed in the key resources table.
-
bioRxiv - Biochemistry 2020Quote: ... ADAR1 and PCBP2 cDNA were cloned from human thymus plasmid cDNA library (Clontech) using standard PCR techniques and then subcloned into indicated vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... The human ezrin sequence was cloned into a pEGFP-N1 (Clontech; 6085-1). The human MISP and EGFP-MISP sequences were subcloned into modified pFastBac-6xHis-MBP plasmid LIC expression vector (Addgene ...
-
bioRxiv - Microbiology 2021Quote: The human kidney epithelial cell line Lenti-X 293T was purchased from Takara. The human liver cell line Huh7.5.1 was provided by Dr ...
-
bioRxiv - Immunology 2020Quote: The human epithelium kidney 293T Lenti-X cells (Clontech Laboratories, Mountain View, CA) were maintained in Dulbecco’s Modified Eagles medium (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... was inducibly expressed in Lenti-x-293T human female kidney cells from Takara Bio (Catalog # ...
-
bioRxiv - Cell Biology 2020Quote: ... S5C-E was generated by fusing human Rac1 cDNA into EGFP-C1 (Clontech) and kindly provided by Dr ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... mCherry-tagged human SREBP-1c was inserted into pmCherry (mCherry-SREBP-1c) (Clontech), and HA-tagged hamster SCAP ...