Labshake search
Citations for Takara Bio :
651 - 700 of 1523 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... qPCR or qRT-PCR was performed using TB Green® Premix Ex Taq™ II (Takara, Japan). 25S RNA and NbActin2 were used as internal references for DNA and RNA normalization ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... synthesized cDNA with the ReverTra Ace qPCR RT Master Mix (TOYOBO) and used TaKaRa Ex Taq (TaKaRa) for amplification of NSP and MA genes ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR reaction was prepared by TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (Takara, #RR420A) and detected by CFX Connect Real-Time PCR Detection System (BIO-RAD ...
-
bioRxiv - Microbiology 2020Quote: ... The synthesized cDNA was subjected to RT-qPCR using TB Green Premix Ex Taq II (Takara Bio). The PCR conditions were set as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... Viral titer was determined using a qPCR Lentivirus Titration Kit (Lenti-X, qRT-PCR Titration Kit, Takara). For smaller scale virus preparation ...
-
Pleiotropy in FOXC1-attributable phenotypes involves altered ciliation and cilia-dependent signalingbioRxiv - Genetics 2020Quote: ... qPCR reactions were run with SYBR® Premix Ex Taq (Tli RNAse H Plus) master mix (Clontech) on LightCycler® 96 Instrument and analysed using LightCycler® 96 Application (Roche Life Science) ...
-
bioRxiv - Neuroscience 2024Quote: ... The target genes were amplified by qPCR according to the instructions of kits (Cat.no. 638315 Takara, Japan), reversely ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR quantitation of mRNAs was performed using TB Green™ Premix Ex Taq™ II (TaKaRa) with Applied Biosystems StepOnePlus Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... qRT-PCR was performed using the SYBRGreen included in the BacPAK™ qPCR titration kit (Clontech, USA) and a StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Pathology 2022Quote: ... Quantitative real-time PCR was performed by TB Green Fast qPCR Mix (Takara Bio Inc. Kusatsu, Japan) on a PCR System (Roche ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The kit used for qPCR experiments was PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa, Japan), HiScriptII 1st Strand cDNA Synthesis Kit (Vazyme Biotech Co. ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was performed using a TB Green®Premix Ex Taq™II (TaKaRa, Lot: AL51019A), and β-actin gene was used as a reference gene ...
-
Aromatase in adipose tissue exerts an osteoprotective function in male mice via phosphate regulationbioRxiv - Physiology 2024Quote: ... RT-qPCR was performed using cDNA to evaluate gene expression with Thermal Cycler Dice (Takara Bio, Inc.) and SYBR Premix Ex Taq II (RR820S ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative real-time polymerase chain reaction (qPCR) was performed using TB Green Premix Ex Taq Kit (Takara) on QuantStudio 6 Flex Real-Time PCR System (Life Technologies) ...
-
bioRxiv - Immunology 2024Quote: ... and PCR was performed on a Roche Light Cycler 480 machine using SYBR Advantage qPCR Premix (Clontech). Parameters for amplification ...
-
bioRxiv - Cell Biology 2024Quote: ... quantitative polymerase chain reaction (qPCR) analyses were performed employing a TB-Green-based PCR kit (Takara, RR82WR) in conjunction with a Real-Time PCR system (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR templates were generated by PCR reaction with biotinylated primers using high fidelity ClonAmp HiFi PCR mix (Takara Inc.). A mixture of Cas9-mSA mRNA (75ng/μl) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara). The reactions were carried out as follows ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg total RNA was used for cDNA synthesis by oligo(dT)18 primer according to the manufacturer’s protocol (Takara). The resulting cDNA was subjected to relative quantitative PCR using the ChamQ™ SYBR qPCR Master Mix (Vazyme Biotech Co.,Ltd ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR templates were generated by PCR reaction with biotinylated primers using high fidelity ClonAmp HiFi PCR mix (Takara Inc.). A mixture of Cas9-mSA mRNA (75ng/ml) ...
-
bioRxiv - Microbiology 2021Quote: ... Thirty-five cycles of L reaction with 0.4 mM barcoded TprK forward and reverse primers (S1 Table) using the 2x CloneAmp MasterMix (Takara) with a 62°C annealing temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR reactions were performed with gene-specific forward and reverse primers using the PrimeScript RT-PCR kit (TaKaRa) on the StepOne Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... acaule was converted into cDNA with ReverTra Ace (TOYOBO, Osaka, Japan) using a random primer (TAKARA BIO, Kusatsu, Japan). cDNA diluted 10-fold with water was used as a template for PCR ...
-
bioRxiv - Cell Biology 2021Quote: Point mutation primers were designed (Table S1) for PCR using 42B3-scFv as a template with Prime STAR (TaKaRa). KOD one PCR Master Mix Blue (Toyobo ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cDNA was amplified with gene-specific primers (Supplemental Table 1) and SYBR Premix Ex Taq II kit (TaKaRa). Data were analyzed using a 2−ΔΔCt method.
-
bioRxiv - Cancer Biology 2021Quote: ... with PCR using the primers listed in Table 1 and cloned into pmCherry-C1 (CMV promoter; Takara Bio Inc.). pEGFP-C3 K19 WT ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and ii) because the relevant primer sequence is proprietary (both confirmed by Takara EU tech support in November 2020), so that we initially did not have access to its sequence ...
-
bioRxiv - Genetics 2020Quote: ... 0.1 μM final each primer in the set and 2.5 U TaKaRa Taq™ DNA Polymerase (TaKaRa, cat. R001A). Cycling was performed using a touch-down approach ...
-
bioRxiv - Genomics 2021Quote: ... The purified poly(A)+ RNA was reverse-transcribed with oligo(dT) primer and reverse transcriptase XL (AMV) (Takara Bio).
-
bioRxiv - Cell Biology 2021Quote: ... of PINK1 or OMA1 encoding plasmid using appropriate primers followed by Gibson assembly (In-Fusion HD Cloning system, Clontech) into the SalI-XhoI of the pLenti-CMV-Neo vector ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Plant Biology 2023Quote: ... T-DNA insertions were then analysed using specific primers (Table S1) in PCR reactions with Emerald Master Mix (Takara). PCR conditions were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... using the primers listed in S-Table 1B into pcDNA3.1-P2A-tagRFP by the In-Fusion HD Cloning Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: Primers oAS344 and oAS345 were then both used to amplify the cDNA using CloneAmp PCR Master Mix (Takara 639298) according to manufacturing protocol ...
-
bioRxiv - Microbiology 2024Quote: ... was amplified with primers Fe-227S and Fe-204R using SYBR Premix Ex Taq II (Tli RNaseH Plus; Takara) (Table 2) ...
-
bioRxiv - Cell Biology 2023Quote: ... Conventional reverse transcription with random hexanucleotide primers was then performed using the RNA to cDNA EcoDry Premix (639549, TaKaRa) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... using specific primers flanked by 15bp overlapping regions from pL6-var2csa-promoter-deletion plasmid and pUF1_Cas9 (list of primers, see Supplementary Table S8) that allowed the cloning by infusion cloning (Clontech, Takara Bio USA ...
-
bioRxiv - Neuroscience 2023Quote: ... the insert was amplified using primers (Key Resources Table) designed with the In-Fusion Cloning Tool (Takara-bio Inc.). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... Technical duplicates were performed with thirty-five cycles of PCR in a 50 μL reaction with 0.4 mM TprK forward and reverse primers (Table S4) using the 2x CloneAmp MasterMix (Takara) with a 62°C annealing temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... The expression profile of target gene was evaluated using specific primers and SYBR green RT-PCR master mix (Takara) in BioRad Real-time PCR instrument ...
-
bioRxiv - Molecular Biology 2024Quote: ... The synthesized cDNA was then used as a template for PCR amplification of AjRTMP1 cDNA using the primers AjRTMP1dsRNA_F and AjRTMP1dsRNA_R listed in table S5 and TaKaRa Ex Taq (TaKaRa Bio). The resulting PCR product was subsequently cloned and inserted into the pMD20-T vector (TaKaRa Bio ...
-
bioRxiv - Genomics 2024Quote: ... cDNA was synthesized using polydT primers and a SMARTer PCR cDNA Synthesis Kit (Cat# 634926, TaKaRa Bio, Shiga, Japan), and double-stranded cDNA was synthesized via downstream large-scale PCRs using PrimeSTAR GXL DNA Polymerase (Cat# R050A ...
-
bioRxiv - Cell Biology 2024Quote: ... The expression profile of all genes of interest was evaluated using RT primers by using SYBR green mix (Takara) in a Biorad Real-Time PCR machine ...
-
bioRxiv - Biochemistry 2024Quote: ... media gDNA or cDNA (generated with SuperScript IV, ThermoFischer) via PCR (PrimeStar, Takara Bio #R045B, primers in Table S9), and the PCR products were ligated with AgeI- and XhoI-(New England BioLabs ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Neuroscience 2024Quote: ... Genomic recombination assay was performed using PCR primers that flank exons 4-6 of mouse Galnt2 (F: 5’-GTACGTGAGACAGGCCTAAGG-3’ R: 5’-CAAGCTTCATTTAGGACCAAGC-3’) and EmeraldAmp PCR Master Mix (Takara Bio, San Jose, CA). PCR cycling parameters were as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...