Labshake search
Citations for Takara Bio :
751 - 800 of 1523 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Molecular Biology 2022Quote: ... gDNA extracted and PCR genotyped with primers (Supplemental table 1) flanking each homologous arms using PrimeStar GXL DNA polymerase (Takara). Correctly targeted clones were further expanded and banked ...
-
bioRxiv - Plant Biology 2022Quote: ... phyllopogon (line 511) using primers listed in Table S1 with KOD FX Neo (TOYOBO) or PrimeSTAR GXL DNA Polymerase (Takara). The amplicons were subcloned using pGEM-T Easy Vector Systems Kit (Promega ...
-
bioRxiv - Bioengineering 2022Quote: ... the gel-purified RNA was reverse transcribed into cDNA using a PrimeScript RT Reagent Kit with random primers (TAKARA, RR037B), followed by PCR with primers that can amplify transcripts across the splice junction ...
-
bioRxiv - Biophysics 2022Quote: ... with insertion of N-terminal residues MATLEK a part of the N17 domain and C-terminal residues PQAQPLLPQPQPPPPPPPPPPGPAVAEEPLHRP which comprise the PR (proline-rich) domain containing the C38 domain using primers as a part of In-Fusion cloning protocol (Takara). eGFP-PolyQ31 was adapted from eGFP-PolyQ74 through the variability of Q-length PCR products amplified using CloneAmp HiFi PCR Premix (Takara) ...
-
bioRxiv - Microbiology 2020Quote: ... The circularized DNA was subjected to PCR to generate a sequencing library using Illumina index primers and PrimeSTAR Max DNA polymerase (Takara). The PCR product was loaded and electrophoresed by 8% TBE PAGE ...
-
bioRxiv - Plant Biology 2021Quote: ... the CDS of SWEET5 was amplified by primers P17 and P18 and subcloned into it by In-Fusion® (Takara). The agroinfiltration-based assays were performed as previously described (Gookin and Assmann ...
-
bioRxiv - Plant Biology 2021Quote: ... and USP by their own specific primers (P9-P14) were seamlessly subcloned into corresponding pGTKan3_promoter constructs by In-Fusion® (Takara) following the linearization at XbaI and PstI restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... overhangs (see table for primer sequences) and fused in frame at its carboxyl end via GA to eGFP in the vector eGFP-N3 (CLONTECH), to generate flZEB1-GFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... were generated from pEGFP-C3 K19 WT using the primers listed in Table 1 with the In-Fusion HD cloning system (Takara). GFP and GFP-tagged K19 WT and mutantconstructs were cloned from pEGFP-C3 K19 constructs into pLenti CMV Hygro (plasmid #17484 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1999)) along with the primers listed in Table 1 and the In-Fusion HD cloning system (Takara, Mountain View, CA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the RNA was concentrated and reverse transcribed with a 5’-RACE protocol that appends a new primer site to the cDNA of both cleaved and uncleaved RNA (SMARTScribe, Takara). The cDNA was PCR amplified with primers that add the adaptors for Illumina sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... Seven Ns were added into the primers as the barcode for barcoded-subamplicon sequencing during the first round PCR (PrimeSTAR Max DNA Polymerase, Takara Bio ...
-
bioRxiv - Genetics 2022Quote: ... Reverse transcription was performed using the oligo(dT) primer and avian myeloblastosis virus reverse transcriptase contained in the TaKaRa RNA PCR kit (TaKaRa). RT-qPCR was performed using the Kapa SYBR FAST qPCR kit (Kapa Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: All plasmids construction was performed by PCR amplification (CloneAmp HiFi PCR Premix) using appropriate primers followed by Gibson assembly (In-Fusion HD Cloning system, Clontech) into the EcoRI site of pLVX-puro vector (Clontech ...
-
bioRxiv - Zoology 2020Quote: ... followed by the synthesis of cDNA with reverse transcriptase and oligo-dT primers according to the manufacturer’s instructions (TaKaRa, Japan). The 2−ΔΔCt method was used to evaluate the quantitative variation ...
-
bioRxiv - Plant Biology 2020Quote: ... Total amount of 1 μg RNA was used as template for first-strand cDNA synthesis with the oligo(dT) primer and the PrimeScriptTMRT reagent Kit with gDNA Eraser (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Reverse transcription was then performed using the oligo (dT) primer and Avian myeloblastosis virus reverse transcriptase contained in the TaKaRa RNA PCR kit (TaKaRa). We conducted RT-PCR using KOD One (TOYOBO ...
-
bioRxiv - Microbiology 2021Quote: ... and NCIMB8826R using the pts1BCA_trunF (5’-TCGTCACCGAGTGTTCGTTT) and pts1BCA_trunR (5’-AGTTGCTGGCCACTGTTCAT) primers (Table S8) and ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Pathology 2020Quote: ... Single stranded cDNA was synthesized with the oligo(dT) primer using PrimeScript™ RT reagent Kit with gDNA Eraser (Takara), the obtained cDNAs were analyzed by real-time PCR ...
-
bioRxiv - Pathology 2021Quote: ... 5 µL of 1:10 diluted cDNA samples was used as the qRT-PCR template with 0.5 µM gene-specific primers and 10 µL SYBR Premix Ex Taq II (Takara, China) in a total volume of 20 µL ...
-
bioRxiv - Developmental Biology 2020Quote: ... This allowed the HA tags to be replaced with GFP (amplified with primers including the AatII sites from pEGFP-N1 (Clontech). Forward primer ...
-
bioRxiv - Microbiology 2020Quote: ... The double-stranded oligonucleotides were end-labeled with [α-32P]-dCTP with the Random Primer Labeling Kit (Takara, Dalian, China). The binding reaction (28 μl ...
-
bioRxiv - Cell Biology 2022Quote: We used the In-Fusion™ (IF) HD cloning system online primer design website (Takara Bio USA, Mountain View, CA) to create primer sets (Table S1 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The cDNA samples were cloned into a pUC19 vector (PCR-amplified with primers 11 and 12) using In-Fusion HD Cloning Kit (Takara). After transformation into Escherichia coli ...
-
bioRxiv - Plant Biology 2022Quote: The genomic sequence corresponding to the BnaAnng22030D gene and its surroundings was amplified using specific primers (Supplemental Table S1) and PrimeSTAR GXL DNA Polymerase (Takara). The PCR product was cloned and sequenced ...
-
bioRxiv - Plant Biology 2022Quote: ... The genomic DNA sequences surrounding the potential off-target sites were amplified by PCR using specific primers (Supplemental Table S1) and PrimeSTAR GXL DNA Polymerase (Takara). PCR products were analyzed by sequencing.
-
bioRxiv - Molecular Biology 2022Quote: ... PCR amplification with Gateway cloning compatible primers was performed directly on Aag2 gDNA using CloneAmp Hifi PCR pre-mix (Takara), without prior amplification in a TOPO TA cloning vector ...
-
bioRxiv - Plant Biology 2022Quote: ... the PCR products amplified by the primers spanning the introns were purified and cloned into pMD19-T vector (TaKaRa, D102A). About 10~20 clones of each PCR products were sequenced and aligned with the corresponding genes by SnapGene software.
-
bioRxiv - Molecular Biology 2023Quote: ... wild-type ORF was amplified using point mutated primers and cloned into pCS2+ via XhoI/XbaI restriction sites using DNA Ligation Kit (TAKARA). The ORFs of zebrafish etf1b (ENSDARG00000043976 ...
-
bioRxiv - Systems Biology 2023Quote: ... RORC reporter locus was then amplified with a custom primer (ACACTCTTTCCCTACACGACGCTCTTCCGATCT TGGGGTGATCCAAATACCACC) and sequencing libraries were then prepared with SeqAmp DNA Polymerase (Takara). Libraries were then sequenced on an illumina Hiseq 4000 sequencer.
-
bioRxiv - Plant Biology 2024Quote: ... The genomic DNA sequences surrounding the potential off-target sites selected for further analysis (Table 2) were amplified by PCR using specific primers (Supplementary Table S1) and PrimeSTAR GXL DNA Polymerase (Takara) from CRISPR/Cas-edited hairy roots (R1 of E-CP1 [the main root and five lateral roots] ...
-
bioRxiv - Microbiology 2023Quote: ... Genes or gene fragments were PCR amplified with primers (S2 Table) to allow for In-Fusion gene cloning (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... the first strand primer was annealed to 1 µl of sample RNA before being extended with SMARTScribe reverse transcriptase (Clontech). After the addition of the second strand primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and used with the mixture of specially designed primers (SWITCH2 and RT_universal_primer, Supplementary Table S2) for cDNA synthesis (SMARTScribe Reverse Transcriptase, TaKaRa, Kusatsu, Japan).
-
bioRxiv - Microbiology 2024Quote: ... individual FLAG-HA tagged Vpr genes were amplified from the pLRGatewayIRESeYFP-Vpr plasmids using the primers in Table 2 and subcloned into pLVX-TetOne-puro (Clontech) using EcoRI and BamHI restriction sites ...
-
bioRxiv - Microbiology 2024Quote: ... Y453F and T76G were inserted in plasmid F5 or F1 respectively by Directed Site Mutagenesis using the primers (Supplementary Table 2) and high-fidelity PrimeSTAR GXL DNA polymerase (Takara).
-
bioRxiv - Cell Biology 2024Quote: ... the Sar1 genome template was first amplified from HeLa genomic DNA with following primers (CCGCTCTAGAACTAGTACCCAAATGAGCTCTGGC, CGGTATCGATAAGCTTGCATCAGTATTAAATACACATG) and cloned into pBSIISK(-) by In-Fusion HD cloning Kit (TAKARA). Next ...
-
bioRxiv - Neuroscience 2023Quote: Mammalian expression constructs were mainly generated by Gibson assembly of PCR-amplified coding sequences (primers, Supp. Data File 2) into restriction-digested pC1 (CMV promoter, modified from pEGFP-C1, Clontech) or pCAG (CMV enhancer fused to chicken beta-actin promoter ...
-
bioRxiv - Cancer Biology 2024Quote: ... The full-length cDNA of the human ZNRF3 was acquired from the human CRC DLD-1 cell line by RNA purification using NucleoSpin RNA II kit (Macherey Nagel) and reverse transcription RT-PCR using specific primers and Primescript RT reagent kit (TaKaRa). Then the ORF of the ZNRF3 short variant replaced RNF43 and was assembled into the C-terminal FLAG-tagged vector using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Wildtype and mutant constructs were then PCR amplified using primers to encompass HA-EZH2 + add NotI and PacI for subcloning into pQXCIH (Clontech). See Supplemental Table 1 for the primer sequences ...
-
bioRxiv - Immunology 2022Quote: The full-length sequences of sea perch RNF34 (GenBank accession number: OP784387) was amplified by PCR using primers (S1 Table) and was subsequently cloned into pCMV-Flag/Myc vector (Clontech). RNF34 deletion mutants (RNF34ΔRING and RNF34ΔZinc ...
-
bioRxiv - Microbiology 2023Quote: ... Subsequently the 1086 bp downstream of the pv6 gene was amplified using primers CVO675 and CVO676 and introduced into pBLD701 at the AflII site using InFusion (Takara), producing pBLD702 ...
-
bioRxiv - Cell Biology 2023Quote: ... Single-stranded cDNA was reverse transcribed from 500ng total RNA using reverse transcriptase and oligo(dT) primer (Takara, Catalog#RR036). Real-time qPCR amplification was performed using the PrimeScript™ RT-PCR Kit (Takara ...
-
bioRxiv - Biophysics 2023Quote: Sublibraries of different regions of SLC22A1 were PCR amplified using primer-specific and polymerase (PrimeStar GXL DNA polymerase) (Takara Bio). A total of 11 regions were PCR amplified ...
-
bioRxiv - Developmental Biology 2023Quote: ... dsDNAs were amplified by PCR using modified primers with 5’Bioton – 5 x phosphorothioate bonds (synthesized by eurofins) and PrimeSTAR Max (Takara).
-
bioRxiv - Genetics 2023Quote: ... The whole fkbA locus from the FK506 resistant isolates was amplified using primers JOHE52223 and JOHE52224 and LA Taq DNA polymerase for long-range PCR with GC Buffer I (Takara). PCR conditions were optimized for long fragments as follows ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA using the indicated primers (Table S1).Fluorescent reporters were ordered as gBlocks and cloned using the In-fusion HD EcoDry Cloning kit (Takara). Promoter reporter constructs were created as previously described (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A repair plasmid to replace the coding sequence of SOS1 with an HXGPRT-mCherry construct was generated by amplifying the 5’ and 3’ UTRs of SOS1 (adjacent to the protospacers in the Cas9-sgRNA plasmid) using primers 81-84 and inserting the resulting fragments into the pTKO2 plasmid27 by In-Fusion cloning (Takara). Parasites were co-transfected with both the Cas9-sgRNA and pTKO2 plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was synthesized with the PrimeScript 1st Strand kit with an additional primer mix containing random DTs (#RR047A and #6110A, Takara). cDNAs were amplified using specific Taqman probes ...