Labshake search
Citations for Takara Bio :
951 - 1000 of 1523 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Ct values were obtained from PCR tests conducted as administrative tests at the Toyama Institute of Health using the SARS-CoV-2 direct detection RT-qPCR test kit from Takara Bio Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... quantitative real-time PCR (RT-qPCR) was performed using the cDNA libraries as the template and a TB Green Premix Ex Taq kit (Takara) in a CFX96 real-time PCR machine (BioRad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The quantitative real-time-polymerase chain reaction (qPCR) was conducted with SYBR Premix Ex Taq™ II (Takara, Dalian, China), and performed on on a QuantStudio™ 7 Flex Real□ Time PCR System ...
-
bioRxiv - Molecular Biology 2024Quote: ... AAV titer was determined by qPCR method using AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara-bio, #6233) following the manufacturer’s protocol.
-
bioRxiv - Immunology 2024Quote: ... and used as a template for qPCR with TB Green® Premix Ex TaqTM II (Tli TNaseJ Plus) (Takara, #RR820L) and the following primers (Eurofins):
-
bioRxiv - Neuroscience 2024Quote: ... The resulting cDNA was used as a template for PCR with THUNDERBIRD SYBR qPCR mix (TOYOBO) on a Thermal Cycler Dice real-time system TP800 (Takara). Expression of genes of interest was standardized relative to rp49 or actin ...
-
bioRxiv - Pathology 2024Quote: ... Gene expression analysis was determined by quantitative PCR (qPCR) using the commercial master mix Premix Ex Taq (Takara; Otsu, Japan) and predesigned TaqMan-based qPCR assays for target and housekeeping genes (Table 2 ...
-
bioRxiv - Microbiology 2024Quote: ... the PrimeScript 1st strand cDNA Synthesis Kit with gDNA Eraser was used to reverse transcribe 1 μg total RNA onto the first strand of cDNA in each pool for qPCR (TaKaRa). qRT-PCR was carried out using a 10 μL reaction volume consisting of 5 μL qPCR Mix (Low ROX ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The RNA copies of SARS-CoV-2 was quantified by RT-qPCR targeting the S gene using the One Step PrimeScript RT-PCR Kit (RR057B, Takara) with specific primers and probes ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was dissolved in 20 μl of RNase free water and qPCR was performed using One step TB green mix (Takara).
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: Ad vectors were constructed using Adeno-XTM Adenoviral System 3 (Takara Bio). The ACE2 and TMPRSS2 genes were amplified by PCR using cDNA generated from Pulmonary Alveolar Epithelial Cell Total RNA (ScienCell Research Laboratories ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Cell Biology 2021Quote: Both mAlkbh5 and mAlkbh5-HAtag were amplified from the cDNA using gateway forward and reverse primer using PrimeSTAR GXL DNA Polymerase (Takahara Clontech # R050A-TAK), and the PCR product was purified using QIAquick PCR Purification Kit (Qiagen #28106) ...
-
bioRxiv - Immunology 2022Quote: ... RT-PCR products were nested PCR-amplified with primers for IgG VH or IgG VL following the HS DNA polymerase kit protocol (Takara, TAK R010). The IgG VH and IgG VL nested PCR products were purified and next cloned into human IgG1 heavy chain and light chain expression vectors ...
-
bioRxiv - Microbiology 2022Quote: ... A maximum of 500 ng of RNA were reverse transcribed with both oligo dT and random primers using a PrimeScript RT Reagent Kit (Perfect Real Time, Takara Bio Inc.) in a 10 µL reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cDNA used for qRT-PCR were synthesized using PrimeScript reverse transcriptase with oligo dT primer and Prime Script RT Enzyme MIX I (Takara, Osaka, Japan). qRT-PCRs was performed using the ChamQ SYBR Color qPCR Master Mix (Q411 ...
-
bioRxiv - Microbiology 2021Quote: ... The forward primer contained a Kozak sequence and both primers contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). To make pmCherry-N1-Gal3 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse-transcribed into cDNA using random hexamer primers and the PrimeScript RT Reagent Kit with gDNA Eraser (Perfect Real Time; Takara, Dalian, China). For the target genes ...
-
bioRxiv - Cell Biology 2021Quote: The SYP121 DNA (obtained from Riken) was amplified from cDNA with primers excluding the transmembrane domain and cloned into the pGADT7 vector (Clontech Laboratories, Inc.). All other exocyst constructs used in the study have been previously described [38,48,73](Hála et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... and a separate master mix was prepared for each primer set using the TB Green® Premix Ex Taq II (TLi RNaseH Plus) reagent kit (RR820A, Takara Bio). The final master mix contained primers at a concentration of 0.4 µM and a 1X concentration of TB Green® Premix Ex Taq II (TLi RNaseH Plus) ...
-
bioRxiv - Microbiology 2021Quote: ... plantarum 16S rRNA genes were amplified from individual colonies using the 27F and 1492R primers (Lane et al. 1991) (Table S8) with ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Bioengineering 2020Quote: ... cDNA was synthesized using a mix of random hexamers – oligo d(T) primers and PrimerScript reverse transcriptase enzyme (Takara bio inc. Kit), again following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The human WT Trop-2 and the Trop-2-Q118E mutant cDNAs [70] were amplified by PCR method (primers: F’ gcgattctcgagtccggtccgcgttcc-XhoI and R’ gcgccggtaccaagctcggttcctttc-KpnI) and sub-cloned into the pEYFP-N1 vector (Clontech, OH, USA) for mammalian expression to give the Trop-2-pEYFP-N1 and Trop-2-Q118E-pEYFP-N1 plasmids.
-
bioRxiv - Cell Biology 2023Quote: ... KOD FX DNA polymerase (TOYOBO) and primers (supplementary table 1) and then cloned into the BamHI site of pLVSIN-EF1 α Hyg vector (Takara Bio) using an In-Fusion HD Cloning Kit (Takara Bio) ...
-
bioRxiv - Plant Biology 2022Quote: ... 2006) using primers pDAN0869 and pDAN0870 and recombined with pK7SHHc digested with AvrII using In-Fusion HD cloning (Clontech, Mountain View, California) to generate pK7-VEN-SHHc.
-
bioRxiv - Molecular Biology 2022Quote: ... and amplified by PCR using a forward primer containing a T7 promoter sequence (Supplemental Table 10) with the Advantage HF 2 kit (Takara Bio 639124) and the following cycling conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg RNA was subsequently converted to cDNA using random hexamer primer using PrimeScript™ 1st strand cDNA Synthesis Kit (Takara Bio) in accordance with manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and co-transfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Genomics 2024Quote: ... we generated a second strand by performing one PCR cycle using only the reverse primer with Seqamp DNA polymerase (Takara Bio., 638504) in SeqAmp CB PCR buffer (Takara Bio. ...
-
bioRxiv - Cancer Biology 2024Quote: ... about 200-bp genomic sequences surrounding each sgRNA-targeted site were amplified using specific primers by PrimeSTAR® GXL Premix (TAKARA, #R051A), followed by NGS analysis on Illumina HiSeq X TEN platform ...
-
bioRxiv - Cell Biology 2020Quote: The commercially available Cellartis Human iPS Cell Line 12 (Takara Bio Inc., Kusatsu, Japan) was used as the human iPS Cell line ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA from the human brain (#636530) and testis (#636533) was purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... was generated by PCR amplification of human S1R gene (www.ncbi.nlm.nih.gov/nuccore/NM_005866.3) and cloning into pEGFP-N2 vector (Clontech) using HindIII/XbaI cloning sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Transplanted hiOLs were identified using anti-human cytoplasm (STEM121; Takara, Y40410, IgG1, 1:100), anti-human nuclei (STEM101 ...
-
bioRxiv - Cell Biology 2021Quote: ... The human fimbrin sequence was cloned into a pEGFP-C1 plasmid (Clontech; 6084-1). The human ezrin sequence was cloned into a pEGFP-N1 (Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... The HB-EGF cDNA was obtained from the Human Brain Matchmaker cDNA library (Clontech). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... HEC1 and BUBR1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Immunology 2023Quote: Immunocult-stimulated human CD3+ T cells were retrovirally transduced on Retronectin-coated plates (TaKaRa). 500 µL of cells per well at 0.5 × 106 cells/mL were supplemented with 0.5 mL retroviral supernatant and centrifuged for 90 minutes at 900 g at 32°C ...