Labshake search
Citations for Takara Bio :
901 - 950 of 1523 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 2 µL of the cDNA was used as DNA template in 15-µL amplification volumes with 400 nM of each primer and 7.5 µL of SYBR green master mix (Takara, Beijing, China) using the following cycling parameters ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 μg of total RNA was reverse-transcribed with random primers using the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa) according to the manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... were converted to cDNA with oligo dT primers according to the instructions of the PrimeScript RT reagent Kit with gDNA Eraser (Takara, Japan). Quantitative PCR was performed in accordance with manufacturer’s instructions for THUNDERBIRD SYBR qPCR Mix (TOYOBO ...
-
bioRxiv - Cell Biology 2022Quote: ... C-terminal PA vector was first prepared by insertion of a DNA cassette encoding the PA tag (annealed primer set 28) into the pcDNA3.1(+) vector (digested with XhoI/XbaI) using a DNA Ligation Kit (#6023; TaKaRa, Kusatsu, Japan). The DNA fragment coding for Ms Jaw1 was then amplified by PCR with primer set 29 from pTagGFP2-C Ms Jaw1 (previously described by Kozono et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The ∼21.3 kb cps operon from galF through gnd was amplified in two pieces of overlapping amplicons with primers that also directed recombination with pMQ300 using PrimeSTAR GXL high fidelity polymerase (Takara Bio). Primers to amplify the DNA were 5470 (5’-ttgtgagcggataacaatttcacacaggaaacagctGTGAAGATGAATATGGCGAATTTG-3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... At 48 hpf the GFP + progeny was genotyped using a forward primer in the foxo1a endogenous locus and a reverse primer in the EGFP inserted transgene using a touch-down PCR with the Terra™ PCR Direct Polymerase Mix (639270; Takara). The PCR product was run in a 1% agarose gel to validate its size and the remaining product was sent for Sanger sequence.
-
bioRxiv - Plant Biology 2023Quote: ... 5′ Rapid amplification of cDNA ends (RACE) was performed using the primer-R5 (Supplemental Table 5S) with the 5′ Full Race Core kit (TAKARA, Japan). The bioinformatics analysis of CcSHMT1 sequences show in Supplemental marterial ...
-
bioRxiv - Neuroscience 2023Quote: ... total RNAs were reverse transcribed to complementary DNA (cDNA) using both oligo dT and random primers with PrimeScript RT Reagent Kit (Takara, #RR037A) according to manufacturer’s instructions in the presence of a synthetic external non-homologous poly(A ...
-
bioRxiv - Pathology 2023Quote: ... The cDNA was prepared from the extracted RNAs with oligo (dT) and random primers using the PrimeScript RT reagent kit (TaKaRa, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Target sequences were amplified in a first PCR using gene-specific primers (F1 and R1) and EmeraldAmp GT PCR Master Mix (TaKaRa RR320A). The PCR conditions were ...
-
bioRxiv - Neuroscience 2024Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and co-transfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Plant Biology 2024Quote: ... RLFcds(H161A)/pENTR was used as a template using H184A/-F/H184-R primers with PrimeSTAR Max (Takara Bio Inc., Japan). These mutant RLF/pENTR were used in the same way to perform LR reactions to construct MBP-RLF(H161A) ...
-
bioRxiv - Microbiology 2024Quote: ... were amplified from the cDNA using specific primer sets for each serotype of FCoV and PrimeSTAR GXL DNA polymerase (TaKaRa Bio). Each fragment was cloned into the pGEM-T Easy vector ...
-
bioRxiv - Immunology 2024Quote: ... we mutated these PaqCI sites with the indicated PCR primers (Table S1) and assembled them with In-Fusion cloning (Takara Bio).
-
bioRxiv - Cell Biology 2024Quote: The cDNA was synthesized from 40 ng of total RNA using oligo(dT)15 primers (3805, Takara Bio Inc., Shiga, Japan) and an Avian myeloblastosis virus (AMV ...
-
bioRxiv - Cell Biology 2024Quote: RT-qPCR reactions were performed in triplicate with 1 µl (template: 6.25 ng) of the first-strand cDNA using the canine-specific primer sets (TaKaRa Bio Inc.) and TB Green Premix Ex Taq II (TaKaRa Bio Inc. ...
-
bioRxiv - Genetics 2021Quote: ... and then RT-qPCR was performed using a One Step SYBR PrimeScript PLUS RT-PCR kit (Takara Bio, Shiga, Japan) and Applied Biosystems ABI Prism 7000 Sequence Detection System ...
-
bioRxiv - Genetics 2020Quote: ... qPCR was carried out using TB Green Premix Ex Taq (Tli RNase H Plus) (#RR420A, Takara Bio Inc., Kusatsu, Japan) and the Applied Biosystems StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... qPCRs were carried out using TB Green Premix Ex Taq (Tli RNase H Plus) (#RR420A, Takara Bio Inc., Kusatsu, Japan) and the Applied Biosystems StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: Cultured rat cortical neurons were infected with recombinant lentiviruses at DIV3 and harvested at DIV10 for qRT-PCR using SYBR green qPCR master mix (Takara). Total RNA was extracted from rat cortical neurons using the TRIzol reagent (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Reactions were performed in a total volume of 20 μl containing 10 μl of TB Green Fast qPCR Mix (#RR430A, TAKARA), 0.4 μl of ROX reference dye II ...
-
bioRxiv - Neuroscience 2020Quote: Cultured rat cortical neurons were infected with recombinant lentiviruses at DIV4 and harvested at DIV11 for qRT-PCR using SYBR green qPCR master mix (TaKaRa). Total RNA was extracted from mouse cortical neurons using TRIzol reagent (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... The viral load was measured by RT-qPCR using One-Step SYBR® Primescript™ RT-PCR kit II (Takara). CT values of serum samples were used to calculate serum viral titre according to regression equation built by RNA extracted from 10 µL of 102-106 pfu/mL of ZIKV (PRVABC59 or MP1751) ...
-
bioRxiv - Plant Biology 2020Quote: ... was then used for RT-qPCR using the primers shown in Supplementary Table S1 with THUNDERBIRD SYBR qPCR Mix (TOYOBO) on a Thermal Cycler Dice Real Time System (TaKaRa). Pcal KB211 oprE and recA were used to normalize gene expression ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... Then RNA was reverse-transcribed and amplified using One Step PrimeScriptTM III RT-qPCR Mix kit (Takara Bio, Kyoto, Japan). Primers and probes ...
-
bioRxiv - Molecular Biology 2022Quote: ... All the reactions were performed in duplicates in Premix Ex Taq Probe qPCR Master Mix (2X) (TaKaRa, Japan Cat#RR390) in a final volume of 25µl per tube in a CFX96 Real time PCR system® (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNAs were diluted 1/10 and PCR reactions were conducted using SYBR qPCR Premix Ex Taq II Tli RNase H+ (TAKRR820W, Takara). Primers can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was performed using the THUNDERBIRD SYBR qPCR Mix (Toyobo) and the Thermal Cycler Dice Real Time System II (Takara). The transcript level in each strain was normalized to the internal control (rnpB) ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RNA quantification was performed by RT-qPCR targeting the S gene of SARS-CoV-2 using One Step PrimeScript RT-PCR Kit (Takara) with the following SARS-CoV-2 specific primers and probes ...
-
bioRxiv - Microbiology 2020Quote: ... according to the manufacturer’s instructions and detected by RT-qPCR assays with a One-Step PrimeScript RT-PCR kit (Takara, Japan) using SARS-CoV-2-specific primers on an Applied Biosystems 7500 Real-time PCR System.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Real-time reverse transcription quantitative PCR (qPCR) was performed in duplicate using 1 μL of cDNA from each sample and SYBR Premix Ex Taq (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... was then used for RT-qPCR using the primers shown in Supplementary Table S1 with THUNDERBIRD SYBR qPCR Mix (TOYOBO) on a Thermal Cycler Dice Real Time System (TaKaRa). P ...
-
bioRxiv - Genetics 2021Quote: ... Quantitative PCR was performed using KAPA SYBR Fast qPCR Kits (Nippon Genetics, Japan) on Dice Real Time System Single Thermal Cycler (Takara) or CFX96 Real- Time System (BioRad ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR was performed in triplicate using 1 µL of cDNA in a standard SYBR premix Ex Taq (Takara, Shiga, Japan) on the CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The concentrations of the host and the parasitic RNAs were measured by RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with sequence-specific primers (Supplementary text).
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using TOYOBO THUNDERBIRD SYBR qPCR Mix on a Thermal Cycler Dice Real Time System (Takara Bio). The average threshold cycle value (CT ...
-
bioRxiv - Microbiology 2022Quote: ... and E484Q mutations of the SARS-CoV-2 spike protein were determined by qPCR using mutation detection kits purchased from Takara Bio (Shiga ...
-
bioRxiv - Plant Biology 2023Quote: ... Synthesized cDNA was amplified by real-time quantitative PCR (qPCR) with TB Green Premix Ex Taq (Tli RNaseH Plus) (Takara) using the QuantStudio 3 system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... Immunoprecipitad DNA was analyzed by qPCR and reactions were performed in triplicate with TB Green Premix Ex Taq (Tli RNaseH Plus) (Takara) using the QuantStudio 3 system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... Ct values were obtained from PCR tests conducted as administrative tests at the Toyama Institute of Health using the SARS-CoV-2 direct detection RT-qPCR test kit from Takara Bio Inc ...
-
bioRxiv - Molecular Biology 2022Quote: ... The titer of harvested lentivirus was established using the Lenti-X RT-qPCR Titration Kit (Takara Bio, Cat. no. 631235). A representative calibration plot and LV tittering of pAIO is added as Supplementary data S4.
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The qPCR reactions were carried out and the signals were detected using a real time PCR system (catalog no. TP950, TaKaRa). For RT-qPCR ...
-
bioRxiv - Plant Biology 2023Quote: ... reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) was employed using the SYBR Green PCR Master Mix (Takara, Dalian, China) in a 48-well plate and analysed using a StepOne Real-Time PCR system (PE Applied Biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quantitative PCR (qPCR) was performed on the CFX Connect Real-Time PCR Detection System using SYBR Green PCR Master Mix (TaKaRa). Primer pairs used were listed in Supplementary (Table S2) ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...