Labshake search
Citations for Takara Bio :
701 - 750 of 1523 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Genomics 2020Quote: ... Human universal reference total RNA (Catalog No. 636538, Clontech, Mountain View, CA) was used as a template to synthesize cDNA by reverse transcription ...
-
bioRxiv - Cell Biology 2021Quote: For expression analysis human multiple tissue cDNA panel (MTC™ Clontech, 636742) and human normal brain tissue qPCR array (OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Naïve human PSCs were cultured in the PXGL medium: Ndiff227 (Takara Bio) medium supplemented with PD0325901 (Sigma,1 μM) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... commercially available cDNAs originating from various human tissues were purchased from TaKaRa (detailed sample information is given in Table S3 ...
-
bioRxiv - Cell Biology 2020Quote: ... Adenovirus expressing human SPARC was constructed using Adeno-X expression system (Clontech) as described before 30,31 ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA from human tissues was purchased from Clontech (catalog number 636643). Most of these samples represent pooled RNA from multiple individuals (between 2 and 63 individuals) ...
-
bioRxiv - Neuroscience 2022Quote: ... were purchased from Addgene and Genscript or amplified from human adult and fetal brain RNA (Takara) (see Table S10)(Alford et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... ERManI-YFP was constructed with human ERManI cloned into peYFP-N1 (Clontech) using Hind III and Xma I yielding ERManI fused on its C-terminus to YFP through a 6 amino acid flexible linker (SGGGGS) ...
-
bioRxiv - Developmental Biology 2024Quote: Human naïve cells were cultured in PXGL medium30: N2B27 medium (Takara, Y40002), supplemented with 1uM PD0325901 (Cambridge Bioscience ...
-
bioRxiv - Cell Biology 2023Quote: Human CD34+ HSPCs were cultured overnight on RetroNectin-coated (Takara Bio USA) plates in StemSpan SFEM II medium supplemented with SCF 100 ng/mL ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA from human liver and fetal brain was purchased from Clontech Laboratories ...
-
bioRxiv - Bioengineering 2024Quote: ... The human PBMC total RNA (Takara Bio USA, San Jose, CA, USA) used in this study was derived from normal human peripheral leukocytes pooled from 426 male/female Asians aged 18–54 years old.
-
bioRxiv - Cell Biology 2024Quote: hTERT Human Retinal Pigmented Epithelium-1 (hTERT-RPE-1, Clontech, CA, USA) cells were maintained in Dulbecco’s Modified Eagles Medium combined with high concentration of glucose ...
-
bioRxiv - Immunology 2021Quote: ... and quantitative reverse transcription-polymerase china reaction (RT-qPCR) was performed using SYBR Premix Ex Taq (TaKaRa, China). All procedures were performed following the manufacturer’s protocols.
-
bioRxiv - Genetics 2021Quote: ... The qPCR procedure was carried out according to the kit instructions (TB Green Premix Ex Taq kit, TakaRa). Primers used were as follows:
-
bioRxiv - Plant Biology 2021Quote: ... and used as a template for qPCR assays employing the SYBR® Premix Ex Taq™ II (Takara) with primers listed in Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR for mRNA detection was performed with the SYBR Premix Ex Taq II (Takara Biomedical Technology, China) using Bio-Rad iQ5 detection instrument (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... The qPCR reaction system consisted of 12.5 μL of 2 × SYBR Premix Ex TaqTM II (Takara, Dalian, China), 0.5 μL of upstream and downstream primers (10 mM) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time RT-qPCR was performed on the cDNA (Thermal Cycler Dice Real Time System IIMRQ, Takara Bio) using Takara SYBR Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA products were amplified by qPCR using the SYBR®Premix Ex Taq TM kit (Takara, RR420A, Japan) in an Applied Biosystem 7500 Fast Real-Time PCR System under standard PCR conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... RT-qPCR was performed using SYBR® Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc.). SYBR green detection of PCR products was conducted in real time using a MyiQ single-color detection system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative assessment of relative RNA expression was performed via RT-qPCR using SYBR Premix Ex TaqTM (TaKaRa, Japan). The reference gene ...
-
bioRxiv - Immunology 2023Quote: ... Real-time quantitative RT-PCR (qPCR) reactions were performed with TB Green Premix Ex Taq™ (Takara, RR420A) in 384-well plates in a QuantStudio™ 6 Flex Real-Time PCR System ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR was performed using TB Green® Premix Ex Taq™ (Tli RNase H Plus) (Takara, RR420B) according to manufacturer’s instructions on an Applied biosystems StepOnePlus machine ...
-
bioRxiv - Bioengineering 2023Quote: ... qPCR was performed using TB Green® Premix Ex Taq™ II (Tli RNase H Plus) from TAKARA BIO USA INC (CA ...
-
bioRxiv - Microbiology 2024Quote: ... The viral RNA copy number was standardized using a SARS-CoV-2 direct detection RT-qPCR kit (Takara). Fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara).
-
bioRxiv - Bioengineering 2024Quote: ... qPCR was performed using TB Green® Premix Ex Taq™ (Tli RNase H Plus) (#RR42WR, Takara Bio) with a final forward and reverse primer concentrations of 1 µM and cDNA concentrations of 2.5 ng/µl ...
-
bioRxiv - Cell Biology 2024Quote: ... and the cDNA was used for qPCR using the TB Green® Premix Ex Taq™ (Takara, RR420A), following the supplied protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... An additional BbsI site in the pDONR backbone was eliminated by site-directed mutagenesis using primers noBbsI_F and noBbsI_R (Supplemental Table 1) followed by an In-Fusion reaction (Takara Bio USA). In order to yield the final binary vectors ...
-
bioRxiv - Biophysics 2021Quote: The SNAP-eGFP fusion construct was created by amplifying the SNAP fragment from pIRES-PEX5-SNAP/eGFP-SKL with the primers KR011/KR012 and subcloning it into HindIII/BamHI digested peGFP-N1 (Clontech).
-
bioRxiv - Biophysics 2021Quote: The PEX5L-SNAP fusion construct was created by amplifying the SNAP fragment from pIRES-PEX5-SNAP/eGFP-SKL with the primers KR022/KR026 and subcloning it into SalI/NotI digested peGFP-N1 (Clontech).
-
bioRxiv - Microbiology 2020Quote: ... CTCF BS1 and CTCF BS2 were mutated by site-directed PCR mutagenesis using the primers detailed in Table 1 and Prime Star Max (Takara) mutagenesis kit following the manufacturer’s protocols and confirmed by sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... These gene blocks were amplified and extended using primers P5+P6 (PMM1) and P7+P6 (PMM2) and PrimeSTAR GXL DNA polymerase (Takara)(Table S2) ...
-
bioRxiv - Genomics 2020Quote: ... 0.8μg of Total RNA was utilized as template for RT with random hexamer primers using PrimeScript RT reagent Kit (Takara). qRT-PCR was performed with respective gene-specific primers (PD GFD ...
-
bioRxiv - Developmental Biology 2020Quote: ... we first used primers with overhangs harboring SfiI sites to amplify the IRES-DsRed-Express from pIRES2-DsRed-Express (Clontech). This fragment was then cloned into the NruI site in pUC57-GentR via cut-ligation to generate an intermediate cloning vector pUC57-SfiI-IRES-DsRed-Express-SfiI ...
-
bioRxiv - Genetics 2020Quote: ... Human CAD was PCR amplified from cDNA (Open Biosystems clone ID 5551082) using specific primers (Table S1) and ligated with In-Fusion (Clontech) into NotI linearized pcDNA3.1-GFP ...
-
bioRxiv - Genomics 2021Quote: ... Target regions were amplified by PCR using specific primer sets and high-fidelity PrimeSTAR GXL DNA polymerase (Takara, Shiga, Japan). Sanger sequencing was performed using BigDye Terminator reactions and loaded onto a 3730xl DNA analyzer (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... were PCR-amplified from genomic DNA with primers 19-22 and cloned into the vector pRS29 using ligation-independent cloning (In-Fusion, Clontech). A guide RNA with sequence AATAACGATATTAAATGTAA was cloned into a modified pAIO vector called pCasG85 using primers 23 and 24 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... then removed from the pGEM shuttle plasmid using EcoRI and NotI enzymes and annealed into the DFRS empty plasmid pre-amplified (DFRS empty plasmid primers) and digested by the same enzymes (In-Fusion Kit; Clontech). The control cassette was thus placed on the 3’UTR of the RFP gene.
-
bioRxiv - Neuroscience 2021Quote: ... were reverse transcribed to complementary DNA (cDNA) using both oligo dT and random primers with PrimeScript RT Reagent Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: The target fragments are amplified by PCR using primers (Sangon Biotech, Shanghai, China) and PCR amplification kit (Takara Bio, Japan). The PCR amplifies the DNA fragments including the 1900 bp target ...
-
bioRxiv - Plant Biology 2020Quote: ... Signal peptide– truncated cDNA fragments of AVRs were amplified by PCR by using primer set (Table S2) and inserted into EcoRI and BamHI sites of pGADT7 (prey) or pGBKT7 (bait) vectors (Clontech). sHMA cDNAs were synthesized from total RNAs of rice leaves (cultivar Sasanishiki ...
-
bioRxiv - Plant Biology 2020Quote: ... and reverse-transcribed with T7-oligo(dT)24 as a primer using the PrimeScript II 1st strand cDNA Synthesis kit (TaKaRa). Then the poly(A ...
-
bioRxiv - Plant Biology 2021Quote: ... and HBS1-R (BamHI)] and HBS1 [using primers HBS1-2-F (NdeI) and HBS1-2-R (BamHI)] were amplified and subcloned into pGADT7 vectors (Clontech). Bait and prey plasmids were co-transformed into the yeast strain AH109 according to the manufacture’s introduction (Clontech) ...
-
bioRxiv - Plant Biology 2021Quote: ... The EVD coding sequence (At5TE20395) was directly amplified from wt Col DNA using primers containing appropriate plasmid homology for In-Fusion Cloning (Clontech) into their respective digested binary vector backbones ...
-
bioRxiv - Plant Biology 2020Quote: ... The KK fragment was then amplified from PVX/KK using different sets of primers (Supplemental Table S1) and subcloned into pMD19-T (TAKARA), the BbsI site of pBluescript SK+/OsU6 (Feng et al ...
-
bioRxiv - Cell Biology 2020Quote: ... was amplified using ESRG-S and ESRG-AS primers and inserted into the BamHI/NotI site of a pMXs retroviral vector [39] using In-Fusion technology (Clontech). The primer sequences for the cloning are available in S1 Table.