Labshake search
Citations for Qiagen :
2751 - 2800 of 6247 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... The PCR amplified cDNA construct (from 140–160 bp) was purified using a QIAquick PCR Purification kit (Qiagen). The purified cDNA was directly sequenced using an Illumina MiSeq 2000 platform (Illumina ...
-
bioRxiv - Developmental Biology 2020Quote: ... All samples were pooled in equimolar ratio and PCR purified pooled sample with QIAquick PCR Purification Kit (Qiagen). The purified sample was then run on a 2% E-Gel and the correct size band was extracted for PCR2 (250-270 bp ...
-
bioRxiv - Microbiology 2022Quote: ... The remaining 45 μL of PCR products were purified using a Qiaquick® PCR purification kit (Qiagen, Germany). The purified PCR amplicons were sequenced by Sanger sequencing at GeneWiz ...
-
bioRxiv - Plant Biology 2022Quote: ... The adaptor ligated DNA was amplified by PCR and then purified on Qiagen PCR purification kit (QIAGEN, 28104) to produce the libraries for sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: dPCR was performed using the Qiagen QIAcuity Digital PCR system (Instrument: QIAcuity-00412; Software: QIAcuity Software Suite 2.1.7.182) and the QIAcuity EG PCR Kit (Qiagen; 250111) following manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2023Quote: QRT-PCR was performed by using miScript SYBR® Green PCR Kit (Qiagen, Hilden,Germany Cat No: 218073) with the high-throughput Light Cycler 480 II Real-Time PCR system(Roche ...
-
Development of immortalized rhesus macaque kidney cells supporting infection with a panel of virusesbioRxiv - Microbiology 2022Quote: RNA for quantitative real-time PCR (qRT-PCR) was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the protocol of the manufacturer and eluted in a final volume of 25 μl RNase-free water ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was conducted with cDNA as the template using the Quantitect SYBR Green PCR kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... The purified PCR product was digested with HindIII and BamHI and purified by the PCR purification kit (Qiagen). The purified tapA promoter and gfp-lcn DNA fragments were mixed and ligated with pDG1664 digested with EcoRI and BamHI ...
-
bioRxiv - Genomics 2024Quote: ... Real-time PCR was conducted with cDNA as the template using the Quantitect SYBR Green PCR kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR amplification was carried out in 5 µl reactions using the QIAGEN Multiplex PCR Kit (QIAGEN, Germany). Each sample reaction contained 10–20 ng of genomic template DNA ...
-
bioRxiv - Molecular Biology 2023Quote: 12-30 reactions were pooled and purified by PCR column purification using QIAquick PCR purification kit (Qiagen, 28104). DNA concentration was measured by Nanodrop 1000 (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... The amplification reaction was conducted using a Rotor-Gene-Q PCR Cycler Real-Time PCR system (Qiagen, Australia). The cycling parameters were as follows ...
-
Efficient Methods for Target Gene Manipulation in Haematopoietic Stem Cell Derived Human NeutrophilsbioRxiv - Cell Biology 2023Quote: ... Size was validated by agarose gel electrophoresis and PCR products were purified using QiaQuick PCR Purification Kit (Qiagen). Equimolar amounts of purified DNA fragments (minimum 15fmol ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was conducted with the Mouse Inflammasomes (96-well format) RT2 Profiler PCR Array (Cat. # PAMM-097Z, Qiagen) according to the manufacturers protocol and was read on an Applied Biosystems® ViiA 7 Real-Time PCR System and analysis was conducted on QuantstudioTM Software by Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... The PCR amplified cDNA construct (from 140–160 bp) was purified using a QIAquick PCR Purification kit (Qiagen). The purified cDNA was directly sequenced using an Illumina MiSeq 2000 platform (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR products were cleaned using using the QIAquick® PCR Purification Kit (Qiagen, Cat. No. / ID: 28104) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... PCR products with the correct molecular weight were selected and purified using the QIAquick PCR Purification Kit (Qiagen) to remove impurities ...
-
bioRxiv - Cell Biology 2022Quote: ... total RNA (30ng) including the miRNA fraction was reverse transcribed using the miRCURY LNA RT Kit (Qiagen) as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... All TaqMan RT-qPCR assays were performed on the thermocycler Rotor Gene Q MDx (Qiagen, Courtaboeuf, France) and Lightcycler LC480 (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... Poly(A) tailing and reverse transcription of mature miRNAs was performed using miRCURY LNA RT kit (QIAGEN), with 20 ng of total RNA as input ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1-2 µg of RNA was used for the cDNA synthesis (Omniscript RT Kit (Qiagen, 205111)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 μg of extracted total RNA was reverse-transcribed using the Omniscript RT Kit (205111, Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized from 250 ng of miRNA using the miScript II RT kit (Qiagen, Valencia, CA). Quantitative PCR (qPCR ...
-
bioRxiv - Genomics 2021Quote: ... RNA was isolated as described above and cDNA was synthesized using Omniscript RT (Qiagen Cat. No.205111) per standard methods ...
-
bioRxiv - Genetics 2020Quote: RNA was extracted from the clinical RT samples using QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany), which was then tested for SARS-CoV-2 using Real-time RT-qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Complimentary DNA synthesis was performed with 50 ng total mRNA using Omniscript RT Kit (Qiagen, Germantown, MD) and random nonamers (Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... and 500 ng of RNA per sample was reverse-transcribed to cDNA using Omniscript RT kit (Qiagen) supplemented with RNase inhibitor according to the manufacturer’s instructions ...
-
A Non-invasive, Biomarker Assay for Detecting Chronic Wasting Disease Pathology in White-tailed DeerbioRxiv - Molecular Biology 2022Quote: ... First-strand cDNA synthesis was achieved using the miRCURY LNA RT kit (Qiagen Inc., Valencia, California, USA) also per manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... Two uL of total RNA was used to synthetized cDNA using the miRCURY LNA RT kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 ng of total RNA was reverse-transcribed using the QIAGEN Omniscript RT Kit (Cat#205111, QIAGEN) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2024Quote: ... Labchip analysis was performed to assess the size of small RNAs according manufacturer’s instructions (PerkinElmer).The Reverse transcription was performed on 4 ng RNA using miRCURY® LNA® RT Kit (Qiagen). Real-time quantitative PCR was performed on 40 pg cDNA using specific primers (Supplementary Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... All TaqMan RT-qPCR assays were performed on the thermocycler Rotor Gene Q MDx (Qiagen, Courtaboeuf, France). Amplification was carried out according to the following thermocycling conditions ...
-
bioRxiv - Microbiology 2023Quote: ... following manufactures protocol for 30 min at RT and then column purified using RNeasy Mini Kit (Qiagen). RNA samples were sequenced at Se-qCenter (Pittsburgh ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell knockdowns plated for RT-qPCR analyses were lysed for RNA extraction using RNAeasy kit (Qiagen, 74104), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 ng of total RNA was reverse transcribed using the miRCURY LNA RT Kit (339340, Qiagen, Germany), whilst for each mRNA sample 1 µg of total RNA was reverse transcribed using the High Capacity RT cDNA Kit (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... cDNA was synthesized through reverse transcription (RT) using the RT2 First Strand Kit (cat. no. 330401; Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... and 500 ng of RNA was then reverse transcribed using the Omniscript RT kit (Qiagen, Hilden, Germany). The cDNA from this reaction was used as template for qPCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... in the GAL4 assay and to the human housekeeping hypoxanthine guanine phosphoribosyltransferase (HPRT) (RT2 qPCR Primer Assays, Qiagen) mRNA when performing siRNA analyses.
-
bioRxiv - Systems Biology 2021Quote: ... Differences between samples and controls were calculated based on the 2−ΔΔCT method using RNU6 control primer (Qiagen) as normalizer ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 ng of total RNA was reverse transcribed using oligo dT primers (Qiagen Benelux B.V., Venlo, The Netherlands) and M-MLV Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: Pre-spotted custom plates (96-well format) were designed to comprehend 89 different miRCURY LNA miRNA primers (Qiagen), three assays for small nuclear or nucleolar RNAs as reference candidates (SNORD44 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The reverse transcription step exactly followed SMART-seq2 protocol with 5’-biotinylated TSO (Qiagen, primers see Table S9). The first round of 24-cycle PCR started with 10µl reverse transcription product ...
-
bioRxiv - Microbiology 2020Quote: ... MprA gene was amplified by PCR using Phusion high fidelity polymerase (Fermentas) with the specific primers (Rv0981_Fp-GTGCGAATTCTTGTCG, Rv0981_Rp-TCAGGGTGGTGTTTC)QIAquick Gel Extraction kit (Qiagen) was used to extract the amplicon and was cloned in pET28a+ vector (Novagen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Complementary DNA of microRNAs was synthesized from 5 μg total RNA using microRNA-specific primers (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Knockdown of EN2 gene was conducted by introducing four different siRNA primers into the cells (Qiagen, Hilden, Germany) (Table 2) ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR was conducted using the following 10x QuantiTect primers (diluted in 1.1 mL TE pH 8.0, final concentration: 200nM) purchased from Qiagen: OTR (QT100379036 ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was conducted using the following 10x QuantiTect primers (diluted in 1.1 mL TE pH 8.0, final concentration: 200nM) purchased from Qiagen: OTR (QT100379036 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 µM each of forward and reverse primers (listed in Supplemental information) on Rotor-Gene Q (QIAGEN). The thermal cycling conditions included an initial denaturation step at 95°C for 10 min ...