Labshake search
Citations for Qiagen :
3001 - 3050 of 6247 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... A total of 25 cycles of PCR was performed and the expected PCR products (500-600 bp) were gel purified (Qiagen). NGS was performed on the Ion S5 GeneStudio platform ...
-
bioRxiv - Cell Biology 2021Quote: ... For PCR amplification of the V5 tag cDNA was extracted from cells and a PCR was performed using the QIAquick PCR purification kit (QIAGEN) and the following primer sequences ...
-
bioRxiv - Microbiology 2022Quote: ... Successful integration was confirmed by running diagnostic PCR either directly on culture using BloodDirect Phusion PCR premix or from extracted genomic DNA (DNAeasy Blood & Tissue kit, Qiagen) with CloneAmp HiFi PCR Premix (TakaraBio).
-
bioRxiv - Genomics 2019Quote: ... and then pooled for a single PCR cleanup with the QIAquick 96 PCR purification kit (Qiagen; 60 μL elution volume). Agarose (1.5% w/v ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 161 birds were genotyped for alternative two-base pair variants (TG / CA) using an allele-specific PCR with the Multiplex PCR Kit (QIAGEN) and a set of primers (locus M1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cDNA was used to prepare triplicate reactions for qRT-PCR according to manufacturer’s instructions (QuantiTect SYBR Green PCR kit, Qiagen, 204143), plates were centrifuged shortly and run on a LightCycler 480 (Roche ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time quantitative PCR was performed on the Applied Biosystems 7500 system with QuantiTect SYBR Green PCR Master Mix (Qiagen) and the appropriate primers ...
-
bioRxiv - Microbiology 2019Quote: ... A total of 25 cycles of PCR was performed and the expected PCR products (500- 600 bp) were gel purified (Qiagen). NGS was performed on the Ion S5 GeneStudio system ...
-
bioRxiv - Genomics 2021Quote: ... The PCR products were size-selected on a 1% agarose gel and purified using the MinElute PCR Purification Kit (Qiagen). The pSTARR-seq_human vector (kindly provided by Alexander Stark ...
-
bioRxiv - Molecular Biology 2019Quote: ... Gel electrophoresis in a 1.5% agarose gel was performed and the PCR products were purified from the gel using QIA Quick PCR Purification Kit (Qiagen) and cloned into pCR-TOPO plasmid using TOPO TA cloning kit for Subcloning (ThermoFisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... The construct sequence was amplified using PCR and the resulting product was purified using the QIAquick PCR purification kit from Qiagen. The vector was digested with XhoI and purified using the QIAqucik PCR purification kit ...
-
bioRxiv - Immunology 2021Quote: ... Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen). For analysis by TIDE ...
-
bioRxiv - Genetics 2021Quote: ... Specific primers were designed to cover approximately 500 base pairs around the mutations and the regions were PCR-amplified using Qiagen Multiplex PCR kit (Qiagen). The PCR products were sequenced with corresponding primers using canonical Sanger sequencing at SeqLab-Microsynth (Göttingen ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR amplicons of exon 5 of the mouse Nprl3 gene were purified using a PCR purifications Kit (Qiagen, Hilden, Germany) and sent to the Massachusetts General Hospital Center for Computational and Integrative Biology DNA Core for whole amplicon next-generation sequencing (NGS ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA template for standard curves was prepared by PCR performed in 50 μl reactions containing 25 μl Taq PCR Mastermix (Qiagen), 19 μl PCR-certified water ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed on an Applied Biosciences 7500 Real-Time PCR system following the QuantiTect SYBR Green PCR kit protocols (Qiagen) using Cyclophilin A (Ppia ...
-
bioRxiv - Immunology 2021Quote: ... Amplification was confirmed by running samples on a 2% agarose gel prior to PCR Clean up (QiaQuick PCR Purification kit, Qiagen). Samples were Sanger sequenced (Source Bioscience ...
-
bioRxiv - Microbiology 2022Quote: ... The eluted RNA from tissues and swabs was analyzed by one-step qRT-PCR using 5 μL input RNA with the QuantiFast Probe PCR kit (Qiagen) and primer/probe sets targeting the NiV Malaysia and HeV N gene ...
-
bioRxiv - Developmental Biology 2022Quote: A repair template containing TagRFP-T::AID with homology at the 5’ and 3’ ends to the egl-43 locus was PCR amplified and purified using a PCR purification kit (Qiagen). 3 μl of 10 μM tracRNA (IDT ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was confirmed for correct size by agarose gel electrophoresis and purified using a PCR purification kit (Qiagen). The vector pBOMBL12CRia(topA)::L2 was digested with Fast-digest SalI and treated with alkaline phosphatase as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were checked using QIAxcel and positive products were purified using the QIAquick PCR Purification kit (Qiagen; Hilden, Germany) and were either sequenced at the Göttingen Genome Sequencing Laboratory (University of Göttingen ...
-
bioRxiv - Immunology 2024Quote: ... DNA surrounding the sgRNA target site was amplified by PCR (STX4-1F: ACAAGGTGGTTAAGGTGGCA; STX4-1R: CTGTTCACAGGGAGACCGAC) and purified using the QIAquick PCR Purification Kit (Qiagen) per manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products were purified with the Promega Wizard SV Gel and PCR clean-up system or the Qiaquick PCR purification kit (Qiagen). For restriction enzyme cloning ...
-
bioRxiv - Immunology 2024Quote: ... 1 μl of the first round PCR product was used as a template for the second nested PCR reaction using HotStartTaq Master Mix Kit (QIAGEN). The cycling conditions for the second PCR reaction were 95°C for 5 min ...
-
bioRxiv - Genetics 2024Quote: ... qRT-PCR was performed in a 10 μL volume using the miRCURY LNA SYBR Green PCR Kit (Qiagen, Hilden, Germany) and the following miRCURY LNA miRNA PCR primer sets (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: Size of PCR fragments was verified using gel electrophoresis and DNA was purified using the QIAquick PCR Purification Kit (Cat# 28104, Qiagen). Concentration was measured using a Quantus™ Fluorometer (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were performed on the extracted DNA or cell suspension using QuantiFast SYBR Green PCR Kit (Qiagen, Hilden, Germany) or QuantiNova SYBR Green PCR Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Real-Time PCR was performed with QuantiNovaTM SYBR® Green PCR Kit following the instruction manual of the kit (QIAGEN) on a LightCycler 480 real-time PCR system (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... primers with an annealing temperature of 60 C for 45 seconds and PCR products purified via the QIA Quick PCR Purification Kit (Qiagen). DNA concentration was measured on the Nanodrop ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total mRNAs were extracted using the Macherey-Nagel RNA easy extraction kit and quantified by qRT-PCR using the QuantiTect SYBR Green qRT-PCR kit (Qiagen) and appropriate primers ...
-
bioRxiv - Genomics 2023Quote: ... The PCR products were pooled and concentrated with ethanol precipitation and further purified using QIAquick PCR purification kit (Qiagen 28106).
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and class II T7 promoter (transcripts starting with +1A or NAD) were produced by PCR and purified by PCR purification kit (Qiagen) by manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Triplicate PCRs were carried out in 15 µl reactions containing 1x UCP Multiplex PCR Master Mix (Qiagen, Venlo, The Netherlands), 0.3 μmol l−1 each of the forward and reverse primers ...
-
bioRxiv - Genetics 2024Quote: ... The first PCR amplified from HTT to GFP (F: ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC, R: GTCCAGCTCGACCAGGATG) Taq PCR Core Kit with Q solution (Qiagen) with 5 µL of the genomic DNA with initial denaturation 95°C (5 min) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR product was treated with 40U Dpn I for 1 hour and was purified by QIAquick PCR Purification Kit (QIAGEN). The purified DNA was quantified by Qubit dsDNA BR kit (Invitrogen).
-
bioRxiv - Microbiology 2024Quote: ... The first PCR was conducted in a 10 μL reaction volume per sample using the Multiplex PCR Plus Kit (Qiagen) with primers 515f/806r (Apprill et al. ...
-
bioRxiv - Genomics 2021Quote: SmRNA-sequencing libraries were prepared from 50 to 150 ng of total RNA using the QIAseq miRNA Library Kit (Qiagen, Germantown, MD) as per the manufacturer’ s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... 100-150 ng/μL of DNA was extracted from 100 mg of ground leaf tissue using DNeasy Plant Mini Kit (Qiagen Inc., Canada) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... The remaining lysate was then transferred to 15 ml tubes containing 5 ml lysis buffer and 150 μl Ni-NTA agarose beads (Qiagen, Venlo, Netherlands) and incubated for 4 h at room temperature under constant mild agitation ...
-
bioRxiv - Immunology 2023Quote: ... from each RNA sample was synthesized in two separate technical replicates from 150 ng of total RNA using QuantiTect Reverse Transcription Kit (Qiagen, cat.: 205311), according to manufacturer’s instructions ...
-
Vegetative nuclear positioning is required for calcium and ROS signaling in Arabidopsis pollen tubesbioRxiv - Plant Biology 2020Quote: ... purified with the QIAquik PCR Purification kit (Qiagen) and subsequently ligated into a pH2GW7 vector (Takagi et al. ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and PCR purification kits were obtained from QIAGEN. All primers and oligos were synthesized from Integrated DNA Technologies ...
-
bioRxiv - Biophysics 2020Quote: ... were purified using a PCR purification kit (Qiagen).
-
bioRxiv - Cell Biology 2020Quote: ... using the Quantitect SYBR Green PCR kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... purified using the QIAquick PCR Purification Kit (Qiagen), and resolved on a 0.8% EtBr–agarose gel ...
-
bioRxiv - Molecular Biology 2021Quote: ... purified using a QIAquick PCR purification kit (Qiagen) and sequenced by the Source Bioscience Sanger Sequencing Service ...
-
bioRxiv - Microbiology 2021Quote: ... followed by column purification (PCR Purification Kit, Qiagen) and elution in 200ul EB buffer.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Purified PCR products were cloned into pDrive (Qiagen) and sequenced by Eurofins Genomics (Ebersberg ...