Labshake search
Citations for Qiagen :
2651 - 2700 of 6247 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The extracted miRNA was reverse transcribed to cDNA using miScript II RT Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and was retro-transcribed using the Qiagen reverse transcription kit (miScript II RT Kit, #218161, Qiagen) and pre-amplified using miScript PreAMP PCR Kit (# 331451 ...
-
bioRxiv - Microbiology 2022Quote: ... The RT-qPCR reactions were performed on a QIAGEN Rotor-Gene Q instrument (Corbett Research, Qiagen) and included an initial denaturation at 95°C for 3 min followed by a two-step cycling protocol consisting of 45 cycles of denaturation at 95°C during 10 s and annealing/extension at 60°C during 10 s ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1 mg of RNA was reverse transcribed to cDNA using the Omniscript RT Kit (Qiagen). qPCR was performed using the TaqMan assay system ...
-
bioRxiv - Plant Biology 2022Quote: Coding sequences of NAS1 (AT5G04950) and NAS4 (AT1G56430) were amplified from cDNA (Omniscript RT Kit, Qiagen) of A ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was harvested from RHΔHXΔKu80 parasites and cDNA synthesized using the Omniscript RT kit (Qiagen 205113) with tgbdp1 specific primers 5’TTCAAAGATATGTCCACCCTCG and 5’CCTTACATCAGCAGACCTGC ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA for RNA-seq and RT-qPCR was extracted using RNeasy Mini Kit (Qiagen, Germany) and treated with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Biochemistry 2024Quote: ... the cDNA was synthesized from the extracted total RNA using the miRCURY LNA RT Kit (Qiagen). Briefly ...
-
bioRxiv - Bioengineering 2022Quote: ... cDNA synthesis was performed from 1.5 μg RNA using RT² First Strand Kits (Qiagen, Hilden, Germany). Custom RT² Profiler PCR Arrays and SYBR® Green PCR Master Mix (Qiagen ...
-
bioRxiv - Bioengineering 2023Quote: ... cDNA was diluted in water and added to the RT² SYBR Green qPCR Mastermix (Qiagen, #330502) then distributed across the 24-wells containing verified assay primers and controls (PCR array reproducibility control ...
-
bioRxiv - Neuroscience 2023Quote: ... and miRNA and mRNA were reverse transcribed into cDNA with the miScript II RT kit (QIAGEN) both according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Five µL RNA was reverse transcribed to cDNA using the miRCURY LNA RT Kit (Qiagen, Germany). MiRs (61 plus 3 controls ...
-
bioRxiv - Developmental Biology 2020Quote: ... with random hexamer primers for cells extract from zebrafish embryos and RNeasy plus Mini Kit (Qiagen, 74034) for HUVEC samples ...
-
bioRxiv - Genomics 2020Quote: ... The primer used in the 3’ RACE assay was designed using CLC Genomic Workbench (ver. 10.1.1, Qiagen) near the highest CAGE-Seq signal in the determined TSS region ...
-
bioRxiv - Plant Biology 2020Quote: ... 2012) using the CLC-main workbench primer design software tool (CLC Main Workbench Version 8.0.1, QIAGEN www.qiagenbioinformatics.com). Standard RT-qPCRs were performed using the PowerSYBR-Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA or cDNA was amplified using the following biotinylated primers and subsequently sequenced using Q24 Pyromark (Qiagen).
-
bioRxiv - Microbiology 2021Quote: Enrichment for viral RNA was performed using the QIASeq™ SARS-CoV-2 Primer Panel V2 (Qiagen) Panel V2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Primers (not designed to determine specific splice variants, but to detect all variants) were purchased from Qiagen for ...
-
bioRxiv - Immunology 2021Quote: ... Resulting cDNA served as template for the amplification of transcripts from Ubc (QT00245189, QuantiTect Primer Assay, Qiagen), Hprt (mm00446968_m1 ...
-
bioRxiv - Microbiology 2023Quote: ... Primers for Jamaican fruit bat genes (Supplemental Table 2) and qPCR was performed (QuantiTech SYBR Green, Qiagen). Within sample gene normalization was performed on Rps18 (ΔCq) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Gene expression of different fos family genes in zebrafish was analyzed using Quantitect™ Primer Assays (Qiagen) for each individual gene – fosaa ...
-
bioRxiv - Immunology 2023Quote: ... A second round of PCR was performed to generate uniquely barcoded sequencing libraries using the barcode primer plate included in the kit (17μL of working mix which include 12.5μL QIAGEN 2x Multiplex PCR master mix ...
-
bioRxiv - Microbiology 2023Quote: ... 100 nanograms of cDNA was used for qPCR analysis of the identified genes (Quantitect Primer Assay, Qiagen) using the iQ SYBR green supermix (BioRad Cat ...
-
bioRxiv - Microbiology 2023Quote: Mouse cDNA was amplified with gene-specific primers (see below) and a HotStarTaq Master Mix Kit (Qiagen). Amplicons were cloned and inserted into a pGEM-T vector (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... with mycobacterial genome-directed primers.60 The qPCRs were run in the Corbett Rotor-Gene 6000 (Qiagen) using the 2×SYBR green master mix (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: Amplification and sequencing primers (Table S3) were designed by using the PyroMark Assay Design Software (v2.0, Qiagen) for the region of interest ...
-
bioRxiv - Biophysics 2021Quote: ... The PCRs of each sample were then pooled and purified using the MinElute PCR Purification Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... the product from the first round of PCR was purified by QIAquick PCR Purifcation Kit (Qiagen, Germany), 10 μl of the purified product was used in each 25 μl PCR reaction ...
-
bioRxiv - Genomics 2020Quote: ... We cleaned the resulting PCR amplicons by following the manufacturer’s protocol with a PCR purification kit (Qiagen).
-
bioRxiv - Physiology 2019Quote: ... Then the PCR product was purified using a QIA quick PCR purification kit (QIAGEN, Inc., Valencia, CA) and cloned to the plasmid ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were digested by DpnI and then purified using the QIAquick PCR Purification Kit (Qiagen, USA). The disruption cassettes were transferred to S ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We performed PCR in a 10 µL volume containing 1x multiplex PCR master mix (Qiagen Hilden, Germany), 5-20 ng of genomic DNA ...
-
bioRxiv - Microbiology 2020Quote: ... All DNA samples were subjected to real-time PCR analysis using QuantiTect SYBR Green PCR Kit (Qiagen) with primers shown below.
-
bioRxiv - Microbiology 2020Quote: ... All the PCR products were then purified with the QIAquick 96 PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The three PCR fragments were digested with DpnI and purified with a Qiagen PCR Purification Kit (Qiagen). The three PCR products were assembled as one large fragment (5’ cynX - insert - lacA3’ ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified using either a QIAquick PCR purification or gel extraction kit (Qiagen, Hilden, Germany). Sanger sequencing of purified PCR products was performed by Eurofins ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Developmental Biology 2022Quote: ... 8 to 10 independent PCR reactions were pooled together and purified using the PCR purification kit (Qiagen). Multiplexed libraries were sequenced on Illumina HiSeq 2500 to obtain 100 bp single-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were digested by DpnI and then purified using the QIAquick PCR Purification Kit (Qiagen, USA). The disruption cassettes were transformed to S ...
-
bioRxiv - Genomics 2022Quote: ... by replacing the standard spin columns with the QIAquick PCR filter columns (QIAquick PCR Purification Kit - Qiagen), selecting for smaller fragments of DNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR reactions were performed in 10 µl volume with 5 µl Qiagen multiplex PCR mixture (Qiagen, Germany), 0.2 mg/ml Bovine Serum Albumin (BSA) ...
-
bioRxiv - Neuroscience 2021Quote: ... While qRT-PCR analysis for other genes was performed using QuantiTect SYBR Green PCR kit (Qiagen, Germany) on a StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR for miRNA and mRNA was performed using a miScript SYBR green PCR kit (Qiagen, Valencia, CA) and detected with a CFX96 detector (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 ng of bisulfite converted DNA was run in a PCR using the PyroMark PCR kit (Qiagen) and the following PCR primers ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR products were purified using QIAquick PCR product purification kit following manufacturer’s protocol (Qiagen Inc., Germany). Per sample ...
-
bioRxiv - Genomics 2019Quote: ... The resulting PCR reactions were pooled and purified (first using the minElute PCR purification kit of Qiagen, followed by an extra purification step using AMPureXP beads of Beckman Coulter) ...
-
bioRxiv - Genetics 2021Quote: ... The PCR product was purified by passage through a PCR cleanup column following the manufacturer’s protocol (Qiagen). The purified sample was then sequenced using an Illumina platform (Genewiz ...
-
bioRxiv - Microbiology 2021Quote: Amplicons from the PCR amplifications were purified using a QIAquick PCR Purification Kit (Qiagen, Cat No.28104). Sequencing of the PCR product was performed by Capillary Electrophoresis Sequencing (CES ...
-
bioRxiv - Cell Biology 2020Quote: ... All 10 PCRs of a single sample were pooled and purified using QIAquick PCR Purification Kit (Qiagen). The purified PCR product was then separated using 2% agarose gel and gel extracted with the Qiagen Gel Extraction Kit ...
-
bioRxiv - Plant Biology 2019Quote: ... The PCR product was purified by either QIAquick Gel Extraction Kit or QIAquick PCR Purification Kit (Qiagen), cloned into the donor vector pDONR207 using Gateway BP Clonase (Invitrogen) ...