Labshake search
Citations for Qiagen :
1551 - 1600 of 1799 citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 20 ng of genomic DNA derived from sorted neuronal and non-neuronal nuclei of a postmortem human ACC sample (Brain A) was used for bisulfite conversion (EpiTect Bisulfite Kit, Qiagen). For each sample ...
-
bioRxiv - Cancer Biology 2021Quote: RNA/DNA was isolated from the macro-dissected xenografts (injected/contralateral side, separately) and human GBM (AllPrep DNA/RNA Mini Kit, Qiagen). The ratio of human/mouse cells in the xenografts was estimated by species specific PCR (DNA ...
-
bioRxiv - Developmental Biology 2022Quote: RNA samples from freshly thawed human primary hepatocytes (SMC and AQL) or from PSC-hepatocytes were prepared with RNeasy plus micro kit (Qiagen), and 10-20 ng total RNA samples were used for constructing stranded RNA libraries with Swift RNA-seq library preparation kit and sequenced with an Illumina HiSeq 2500 sequencer with 50 base single end reads.
-
bioRxiv - Microbiology 2022Quote: ... Initial gene expression profiling was performed using the 96-well Human Cytokines & Chemokines RT2 Profiler PCR Array (PAHS-150ZC, Qiagen) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... both hNS1 and hNP cells were transfected with human miRNA-mimics (double stranded RNAs that mimic mature endogenous miRNAs, Procured from Qiagen) of the mentioned ...
-
bioRxiv - Bioengineering 2020Quote: Total DNA samples were obtained from human skin biopsy samples (XX, caucasian, 79 yr) using the QIAamp DNA Mini Kit (Qiagen) and applied to the human Illumina Infinium EPIC 850K chip ...
-
bioRxiv - Microbiology 2021Quote: ... RNA-seq FASTQ data were processed and mapped to the human reference genome (hg38) with the CLC Genomics Workbench 20 (Qiagen). Differential gene expression was analyzed with the DESeq2 package in R (Drummond et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen, Catalog#:PAHS-019ZA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was extracted from the sorted cells according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN). After pelleting by centrifugation for 5 minutes at 5,000 x g ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: RNA from human M1 macrophages transfected with SP140 siRNA or scrambled siRNA was extracted using a RNeasy mini-kit (Qiagen). 150 ng total RNA was labelled using the cRNA labelling kit for Illumina BeadArrays (Ambion ...
-
bioRxiv - Biochemistry 2022Quote: ... high molecular weight genomic DNA (gDNA) was purified from human primary T cells using the Blood & Cell Culture DNA Maxi Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... RNA was also extracted from human first and second trimester placental villi using the RNeasy Plus Universal Mini Kit (Qiagen). Libraries were made using the Illumina TruSeq Stranded mRNA Library Kit according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Gene expression of 84 heat shock genes in mock-infected or 229E-infected cells was analyzed using Human Heat Shock Proteins & Chaperones RT2 Profiler PCR array (Qiagen). Real-time PCR analyses were performed with specific primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... We designed species specific MALAT1 tiling primers for human and green monkey (Table S1) and performed multiplex PCRs following Qiagen Multiplex PCR protocol (Qiagen). cDNA was divided equally between primer sets ...
-
bioRxiv - Bioengineering 2022Quote: qRT-PCR of SARS-Cov-2 RNA was performed as previously described.59 RNA was extracted from human lung epithelial cells expressing human ACE2 (A549-hACE2) grown in 96-well plates by using the RNeasy 96 Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... total RNA from normal human or AIL patient neutrophils was isolated using RNeasy Total RNA Isolation Kit (Qiagen, GmBH, Germany)/ TRIzol reagent (Life technologies ...
-
bioRxiv - Physiology 2023Quote: Cytokines secreted from nonapoptotic and apoptotic NCTC cells were screened with the Human Inflammatory Cytokines Multi-Analyte ELISArray Kit (QIAGEN). Nonapoptotic and apoptotic NCTC cell supernatants were prepared in replicate serial dilutions of the Antigen Standard ...
-
bioRxiv - Immunology 2023Quote: Real-time quantitative PCR (RT-qPCR) was done as previously described [Zonneveld 2021] using the Human T cell Tolerance & Anergy RT2 Profiler PCR array (Qiagen). The relative expression levels of each gene were normalized using 4 reference genes (B2M ...
-
bioRxiv - Microbiology 2023Quote: ... Human macrophages were lysed in 350 μL RLT buffer with β-mercaptoethanol and centrifuged through a QIAshredder spin column (Qiagen). cDNA was synthesized from isolated RNA using SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted from sorted cells and from two replicated of in vitro cultured E-A14 cells stabilized in RLT buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Micro Kit (Qiagen). The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: Investigation of the cell cycle related genes in LoVo cell line on treatment with FA FOS I was performed as described above by using the synchronized and 24 h FA FOS I (198 µg/ml) treated cells profiled by using RT2 Prolifer PCR Array- Human Cell cycle from Qiagen. The data was analysed by using Gene globe platform and reactome pathway analysis.
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from the human cell lines and mouse tumor samples was extracted using RNeasy Plus Mini Kits (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from whole lungs from IAV non-infected / infected mice and human PBMCs using (RNeasy mini kit, Qiagen). RNA quantity and purity were assessed using a spectrophotometer (NanoDrop) ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was extracted from newly acquired human embryonic/fetal brain samples (n=32) using the AllPrep DNA/RNA Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Total RNAs were extracted from human benign prostatic cells using RNeasy Mini Kit as per manufacture’s protocol (Qiagen, Cat # 74104). cDNA was synthesized using 2µg of RNA using a high-capacity RNA to cDNA kit (applied biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... The melting curves of amplified product DNA fragments were quantified against the methylation standard curve generated using commercial bisulfite converted human genomic DNAs (Qiagen) and expressed as a mean methylation percentage.
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
cDNA library screening to identify interacting proteins of Golgi-localized type II membrane proteinsbioRxiv - Molecular Biology 2020Quote: ... The cDNA libraries were amplified in DH10B E.coli cells and purified using QIAGEN Plasmid Mega Purification kit (Qiagen, Germany). The average size of the cDNA inserts into pPR3-N was evaluated by purifying 20 random colonies each and digesting with SfiI ...
-
bioRxiv - Genomics 2022Quote: ... supplemented with 100 μg/mL of carbenicillin for 16 hr at 30°C followed by plasmid purification (Qiagen, 12991).
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmid DNA was then extracted with a custom method using reagents from the QIAprep Miniprep Kit (Qiagen cat. #27104) on an automated liquid handler equipped with a positive-pressure filter press.
-
bioRxiv - Microbiology 2019Quote: ... pMo-EGFP-PV-WT plasmid was linearized with ApaI and purified with QIAEX II Gel Extraction Kit (Qiagen, Netherlands). With the linearized plasmid as the template ...
-
bioRxiv - Biochemistry 2020Quote: ... The selected plasmids were purified by use of a QIAprep Spin Miniprep Kit according to the manufacturer’s instructions (QIAGEN). For the reaction products stemming from transcription with natural CTP ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We used the remainder of the culture for extracting the plasmid library using a QIAprep Spin Miniprep kit (QIAGEN). The plasmid libraries thus isolated served as templates for the next round of mutagenesis.
-
bioRxiv - Immunology 2021Quote: Bacterial plasmid DNA was extracted from a 3 ml overnight culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Next ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids were assembled via Gibson Assembly using standard protocols and isolated with the Qiaprep Spin Miniprep kit (Qiagen, USA) (146).
-
bioRxiv - Biochemistry 2022Quote: ... Expression levels were validated from the pWB plasmid by western blot using an anti-His HRP conjugate kit (Qiagen) (Fig ...
-
bioRxiv - Biochemistry 2022Quote: ... The remaining recovery was grown overnight in 150 mL LB + chloramphenicol and plasmid DNA was isolated by MaxiPrep (Qiagen). The complexity of the SpCas9 catalytic and PAM domain libraries were estimated to be 77,400 and 292,600 respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... All selected colonies were cultured overnight and prepared using the HiSpeed Plasmid Maxi Kit (Qiagen, Hilden Germany, cat# 12663) and sequenced at Genewiz (South Plainfield NJ USA ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid DNA was isolated from select transformants using a miniprep kit according to the instructions of the manufacturer (QIAGEN), and the recombinant construct ...
-
bioRxiv - Neuroscience 2020Quote: ... Endotoxin free plasmid preparations of high yield and purity for electroporation was prepared by maxi-prep (Qiagen, Hilden, Germany).
-
bioRxiv - Synthetic Biology 2019Quote: ... or Golden Gate Assembly using standard protocols37 Plasmids were routinely isolated using the Qiaprep Spin Miniprep kit (Qiagen, USA), and all primers were purchased from Integrated DNA Technologies (IDT ...
-
bioRxiv - Genetics 2021Quote: The pEGFP-attB vector with the priEE fragment was prepared at a high concentration using Plasmid Midi Kit (Qiagen) and transported to WellGenetics (Taiwan ...
-
bioRxiv - Biochemistry 2020Quote: ... was PCR amplified from plasmid (pSH515) containing the native His4 gene promoter and purified by PCR cleanup kit (Qiagen). DNA was eluted from the spin column with 10 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2019Quote: 1×106 MIA PaCa-2 or HAP1 cells were seeded per 6 well plate and co-transfected with 0.5 µg pCas-Guide plasmid using Effectene transfection reagent (Qiagen). 24 hrs after transfection ...
-
bioRxiv - Genetics 2020Quote: ... The sgRNA plasmid was linearized with DraI and then purified using a MinElute PCR Purification Kit (Qiagen, Duesseldorf, Germany). sgRNA was produced using the MEGA shortscript Kit (Ambion ...
-
bioRxiv - Biochemistry 2020Quote: ... Standard molecular biological and microbiological techniques were employed for plasmid DNA extraction (QIAprep Spin Miniprep Kit, QIAgen, Venlo, Netherlands), confirmation of Cys residue position via plasmid-based sequencing (Eurofins Genomics ...