Labshake search
Citations for Qiagen :
1301 - 1350 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The protein was isolated using a Ni-NTA column (Qiagen). 25 μg of isolated protein was used to immunize mice by subcutaneous injection with complete Freund’s adjuvant and boosted three times with incomplete Freund’s adjuvant to generate PfATP4 antibody.
-
bioRxiv - Microbiology 2024Quote: ... RNA was isolated using the RNEasy Mini Kit (QIAGEN, cat#74134) and cDNA was synthesized using the Invitrogen High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... RNA extraction was done using the Qiagen RNeasy kit following the manufacturer’s protocol (Qiagen, Hilden, Germany). After DNaseI (Fermentas ...
-
bioRxiv - Microbiology 2024Quote: ... tokunagai were used for DNA extraction using the DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) following the company’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA of whole tissue was extracted using QIAGEN Genomic-tip 100/G (QIAGEN, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was also extracted from approximately 0.5g of ambient surface sediments (wet weight) by using the PowerSoil DNA Isolation Kit (Qiagen, Hilden, Germany). NanoDrop Lite (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... tissue homogenization was carried out by bead beating and immediately followed by RNA extraction using the RNeasy Fibrous Tissue Mini Kit (Qiagen 74704), according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Initial dissociation was conducted RLT buffer (Qiagen) supplemented with dithiothreitol ...
-
bioRxiv - Neuroscience 2024Quote: ... Soma RNA was purified using the RNeasy Mini Kit (Qiagen, Venlo, Netherlands) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... The soma compartment was lysed using 50µl RLT buffer (Qiagen, Venlo, Netherlands), collected and snap frozen using dry ice ...
-
bioRxiv - Neuroscience 2024Quote: Tissue was homogenized using a QIAshredder (Qiagen). RNA was extracted with RNeasy Mini Plus Kit (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA from each sample was isolated using the RNeasy Micro kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... RNAs were isolated from whole infected or non-infected larvae using the RNeasy mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... or QuantiTect Reverse Transcription kit (Qiagen). ZIKV RNA and vglut1 mRNA were detected by droplet digital PCR (ddPCR ...
-
bioRxiv - Microbiology 2024Quote: Bacterial genomic DNA was extracted from 1 mL overnight cultures grown in LB media using a Qiagen DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... If spurious bands were identified the 478 bp fragment was extracted using the QIAquick Gel Extraction Kit (Qiagen 28704) alongside a blank gel lane extraction as a further negative control for environmental contamination.
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from pellets using the DNeasy PowerFood Microbial DNA Isolation Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was prepared using the RNeasy Plus RNA isolation kit (Qiagen) and quantified using Tapestation High sensitivity RNA kit (Agilent) ...
-
bioRxiv - Microbiology 2024Quote: ... DNA gel extraction kit from Qiagen (India), yeast transformation kit from G-Biosciences (USA) ...
-
bioRxiv - Neuroscience 2024Quote: Spinal cord tissue was homogenized using Bertin-Precellys homogenizer in Buffer RLT (Qiagen) supplemented with beta-mercaptoethanol per manufacturer recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... gDNA was isolated using DNeasy Blood & Tissue Kit (QIAGEN). WGS was conducted using Illumina NovaSeq 6000 s4 system with 2×150 bp paired-end technique.
-
bioRxiv - Microbiology 2024Quote: ... gDNA from cells or supernatants were purified with the DNeasy blood and tissue kit (Qiagen). The pCDNA4.TO- ORF39-2xCSTREP plasmid(37 ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was isolated with the RNeasy extraction kit (Qiagen), and cDNA was synthesized with a cDNA synthesis kit (MedchemExpress #HY-K0510) ...
-
bioRxiv - Molecular Biology 2024Quote: ... we sequenced the rbcL F3R3 region of 104 predominant plant species at the study site using the following methods. Total DNA was extracted from plant specimens (ca. 0.8 cm2) using a DNeasy Plant Mini Kit (Qiagen) and purified using a Geneclean Spin Kit (MP-Biomedicals) ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids were purified by Qiagen Plasmid Mega kit and then sent to Viral Core Facility of Universtatmedizin Berlin Charite to be packaged into AAV 2/1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by purification of the RNA transcripts using the RNeasy Kit (Qiagen) as per the supplied protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 µl of 5X PCR buffer (Qiagen; Hilden, Germany), 0.8 µl of 10 mg/ml BSA (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µl Qiagen CL buffer (10x; Qiagen, Hilden, Germany), 0.4 µl MgCl2 (25 mM ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... alphenor females that were homozygous for the h or H alleles using the QIAgen GenomicTip G-100 kit (QIAgen, USA). Extractions followed the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: The RNA was further purified using the RNeasy MinElute Cleanup kit (Qiagen) following the manufacturer’s recommendations with minor modifications ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... or spleen with the DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: RNAseq was performed on RNA extracted and DNAse treated samples using the miRNeasy mini kit (Qiagen) obtained from three replicates of miRNA overexpression ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNAs were purified after digestion on QIAquick columns (Qiagen, Les Ulis, France) and their qualities were controlled using a TapeStation instrument (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... These markers were amplified with the Multiplex PCR kit (Qiagen, Les Ulis, France) using a touchdown program with an initial denaturation of 15 min at 95°C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR mix contained 0.16 µM of each of the fluorescent universal primer and of the reverse specified primer and 0.04 µM of the 5’ tail forward primer in a final 15 µl reaction volume (2x QIAGEN Multiplex PCR Master Mix with 3 mM Mg2+ ...
-
bioRxiv - Molecular Biology 2024Quote: ... Selefa cotton swabs (OneMed, Malmö, Sweden) with nasal secretion were cut into microfuge tubes or Investigator Lyse&Spin Baskets (Qiagen) for DNA extraction on EZ1 ...
-
bioRxiv - Molecular Biology 2024Quote: DNA extraction with EZ1 DNA Investigator kit (Qiagen) was performed according to the manufacturer’s instructions and the large volume protocol [31] ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... and incubated at 37 °C for 30 min followed by immediate purification of DNA fragments with the MinElute PCR Purification Kit (Qiagen). ATAC-seq including amplification of Library and Indexing was performed as described elsewhere67 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The upper phase was carefully poured into 15 mL MaXtract high density gel tubes (Qiagen) and 4 mL of phenol:chloroform:isoamyl alcohol (25:24:1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a protocol and a linear regression model based on fluorometry measurements of dsDNA and ssDNA with Qubit (Qiagen, Hilden, Germany) were developed and validated ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA was extracted and isolated from the bacterial isolates using the QIAamp DNA mini kit (Qiagen, Hilden, Germany) and quantified using the Qubit double-stranded DNA kit (ThermoScientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... The swabs were removed after heat incubation at 56 °C for 2 hours by transferring samples including swab material to QIAshredder tubes (Qiagen) and centrifugation at 12,000 rcf for 2 min.
-
bioRxiv - Genomics 2024Quote: ... RNA was isolated using the RNeasy Microarray Tissue kit (Qiagen).
-
bioRxiv - Molecular Biology 2024Quote: ... and RNA isolation was carried out using an RNAeasy Mini Kit (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified using the RNeasy Mini Kit (Qiagen).
-
bioRxiv - Molecular Biology 2024Quote: ... CpdG or DMSO treated cells with the RNAeasy Mini kit (Qiagen cat #: 74104) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR reactions were cleaned up using the QIAquick PCR Purification kit (Qiagen). Samples with sequencing primers added were sent to the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Genomics 2024Quote: ... The seven clinical samples were extracted using the Qiagen PowerSoil Kit (Qiagen, Hilden, German). For this set of samples ...
-
bioRxiv - Genomics 2024Quote: All the plasmids were prepared endotoxin free using the EndoFree Plasmid Kit (Qiagen) following the manufacturer’s protocol.