Labshake search
Citations for Qiagen :
1351 - 1400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... by running one homogenization cycle (50 Hz oscillation frequency (50 cycles/s) for 4 minutes) in a Tissue lyser LT (Qiagen). Tubes were then centrifuged at 5000 rpm for 5 min ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted from the SCO and hippocampus or cultured neurons using the RNeasy Micro kit (Qiagen, 74004). The DNA library for sequencing was prepared following the protocol for TruePrep DNA Library Prep kit V2 (SCO and hippocampus ...
-
bioRxiv - Pathology 2024Quote: Kidney tissue was homogenized in 600 µl buffer RLT + DTT (Qiagen) using TissueLyser (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mouse thyroid tissue was homogenized in buffer RLT using TissueLyser II (Qiagen; 2x 2 min cycles at 30 Hz) and 5 mm stainless steel beads ...
-
bioRxiv - Cancer Biology 2024Quote: Cells were harvested and resuspended immediately in RNAprotect Cell Reagent (Qiagen, Cat# 76526) for RNA stabilization ...
-
bioRxiv - Pathology 2024Quote: ... RNA was extracted from the lysate using the Qiagen RNeasy mini kit (Qiagen) according to the manufacturer’s instruction.
-
bioRxiv - Pathology 2024Quote: ... using TissueLyser (Qiagen) with settings 2 x 2 min/25.0 ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Germany). The RNA concentration was determined by Qubit dsDNA HS Assay kit (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... 100-200 μm thick sections were cut and used to extract total RNA using the RNeasy Mini Kit (Qiagen, USA). The RNA integrity number (RIN ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and potential DNA contamination was digested with DNase I (Qiagen) during RNA purification according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... Cultures were harvested and DNA purified using a Plasmid Giga Kit (Qiagen). Purified DNA was resuspended in buffer TE and adjusted to a concentration of ∼1 g/L ...
-
bioRxiv - Genetics 2024Quote: ... PCR products were then pooled and purified with a QIAquick PCR Purification Kit (Qiagen), using water to elute from the final columns ...
-
bioRxiv - Genomics 2024Quote: ... pellets were collected and frozen in RTL plus buffer (Qiagen) for the RNA-seq assay.
-
bioRxiv - Genomics 2024Quote: ... total RNA was isolated from cell lysates using AllPrep DNA/RNA Mini Kit (QIAGEN). RNA quality was assessed based on RNA integrity number (RIN ...
-
bioRxiv - Bioengineering 2024Quote: ... the supernatant was incubated with Ni-nitrilotriacetic acid (NTA) agarose resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Total RNAs were isolated using the RNeasy Mini extraction kit (Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Total RNA from BT-474 tumors was extracted using Qiagen RNeasy Plus Universal mini kit following manufacturer’s instructions (Qiagen). The RNA samples were quantified using Qubit 2.0 Fluorometer (Life Technologies ...
-
bioRxiv - Pathology 2024Quote: BM RNA was extracted using RNeasy purification kit (Qiagen, Valencia, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... tissue samples underwent homogenization in a TissueLyser II bead mill (Qiagen, Germantown, MD) at 30 Hz for 3 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... naïve mice and CSDS resilient mice respectively) were analyzed using the Ingenuity Pathway Analysis (IPA) canonical pathway and upstream regulator analysis (Qiagen Ingenuity Systems, Venlo, Netherland). Gene expression changes with absolute values greater than 2 were considered significant.
-
bioRxiv - Developmental Biology 2024Quote: ... and extracted from the gel with the QIAquick Gel Extraction Kit (Qiagen). DNA samples were submitted to the CCHMC Genomics Sequencing Facility for sequencing results.
-
bioRxiv - Genomics 2024Quote: ... 0.5 μL of AllTaq polymerase (Qiagen), and 2 μL of DNA (concentration 4-20 ng/μL) ...
-
bioRxiv - Pathology 2024Quote: One frozen liver piece of 25mg per mouse was homogenized in a closed tube with glass beads and 1mL Qiazol by using the Tissue Lyser (Qiagen) for 5min at 50Hz ...
-
bioRxiv - Immunology 2024Quote: RNA was isolated (RNeasy Micro Kits, Qiagen) from single cell suspensions prepared from knee joints of WT and Sulf2-deficient bone marrow chimera mice sacrificed 7 days after induction of arthritis ...
-
bioRxiv - Microbiology 2024Quote: ... amplification was carried out using a p5 indexing primer comprising the sequence AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC (where [i5] denotes the barcode sequence) and a P7 primer in combination with the HotStarTaq master mix kit from Qiagen. This process added unique barcodes as well as the necessary P5 and P7 flow cell adapter sites required for Illumina sequencing ...
-
bioRxiv - Pathology 2024Quote: ... total RNA was extracted using QiAzol Lysis Reagent (Qiagen; CA; USA) and the miRNeasy Mini Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the supernatant was filtered through Ni-NTA agarose column (Qiagen). After washing with 50 mM imidazole (200 mL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was extracted with spin columns (Cat. No. 74104, Qiagen, Germantown, MD), and RNA-seq using the poly(A ...
-
bioRxiv - Physiology 2024Quote: ... and homogenized in QIAzol Lysis Reagent (QIAGEN, Valencia, CA), and frozen at −80°C for real-time quantitative polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Physiology 2024Quote: ... DNA was extracted using Qiagen DNeasy 96 PowerSoil Pro QIAcube HT kits (Qiagen). Sequencing libraries were prepared with Watchmaker DNA Library Prep kits with Fragmentation (Watchmaker ...
-
bioRxiv - Physiology 2024Quote: ... (ii) the cell pellets were collected and stored in RNAprotect (Qiagen, MD, USA) at -80°C for DNA extraction ...
-
bioRxiv - Physiology 2024Quote: Total RNA was isolated from islets or homogenized tissues and purified using RNeasy columns and RNase-free DNase digestion according to the manufacturer’s instructions (QIAGEN). The quality and quantity of the total RNA was monitored and measured with a NanoDrop (NanoDrop Technologies ...
-
mTORC1-dependent SOCE activity regulates synaptic gene expression and muscle response to denervationbioRxiv - Physiology 2024Quote: Total RNA was extracted with the RNeasy Fibrous Tissue Mini Kit (Qiagen). Quantitative PCR was performed on DNAse-treated RNA ...
-
bioRxiv - Physiology 2024Quote: ... RNA was isolated using the RNeasy Mini Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: Approximately 150–200 mg of placenta tissue was lysed and homogenized in RLT-lysis buffer (Qiagen) using a tissue homogenizer ...
-
bioRxiv - Physiology 2024Quote: ... RNA was extracted and DNase treated using the RNeasy Midi Plus Kit (Qiagen) following standard manufacturers protocols ...
-
bioRxiv - Physiology 2024Quote: ... and RNeasy (Qiagen) hybrid protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was extracted from pennycress or Arabidopsis seedlings using the RNeasy Plant Mini kit (Qiagen) with in-column DNase treatment ...
-
bioRxiv - Physiology 2024Quote: ... Reverse transcription of RNA into cDNA was performed by M-MLV reverse transcriptase and oligo(dT) primers (Qiagen, Toronto, ON, Canada). cDNA was then amplified using aCFX384 Touch Real-Time PCR Detection Systems (Bio-Rad ...
-
bioRxiv - Neuroscience 2024Quote: ... and RNeasy Mini Kit (Qiagen, #74104) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: RNA using Qiazole (Qiagen, #79306) and RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: The fresh-frozen brain tissue from control and epileptic animals was homogenized with a handheld rotor-stator homogenizer (QIAGEN, TissueRuptor II) in a lysis buffer that contains 0.5% Triton X-100 ...
-
bioRxiv - Neuroscience 2024Quote: Tissue was homogenized using a QIAshredder (Qiagen). RNA was extracted with RNeasy Mini Plus Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: An RNeasy kit (Qiagen) was used to purify RNA for RNAseq perturbation and off-target analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted with RNeasy Mini Plus Kit (Qiagen) following supplier’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by purification with the RNeasy Micro kit (QIAGEN, #74004). High-throughput RNA sequencing (RNA-seq ...
-
bioRxiv - Neuroscience 2024Quote: ... and DNA was purified using PCR purification kit (Qiagen). Quantification of the precipitated DNA fragments were performed with real-time PCR using primers listed in Table S4.
-
bioRxiv - Neuroscience 2024Quote: ... gel electrophoresis and subsequent QIAquick™ gel extraction (Qiagen). Linear fragments were then re-ligated using the Rapid DNA Dephosphorylation and Ligation Kit (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... total RNA was purified from cells using the RNeasy procedure (Qiagen, Hilden, Germany). Preparation of RNA library and transcriptome sequencing was conducted by Novogene Co ...
-
bioRxiv - Molecular Biology 2024Quote: DNA-FISH probes were obtained after nick translation of BAC constructs (RP11-45IJN, RP5-915N17) purified using the Large Construct kit (Qiagen): 1 μg of purified DNA was labelled for 3 h at 16° C with fluorescent dUTPs (SEEBRIGHT Orange 552 dUTP and SEEBRIGHT Green 496 dUTP ...