Labshake search
Citations for Qiagen :
1101 - 1150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... The RNA mixture was transferred to a RNeasy spin column (Qiagen) and processed according to the RNeasy kit instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Total RNA was isolated from spinal cord using RNeasy Lipid Tissue Mini Kit (Qiagen Catalog # 74804) and RNase-free DNase kit (Zymo catalog #E1010 ...
-
bioRxiv - Physiology 2024Quote: RNA was extracted from human tissue derived organoids and neutrophils using the RNeasy® Plus Mini Kit (Qiagen, #74104) with cDNA prepared using a SuperScript™ VILO™ cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Physiology 2024Quote: ... RNeasy Mini kits were used (QIAGEN #74104). After extraction ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by an additional cleanup step using RNeasy MinElute Cleanup (Qiagen, Germany) to ensure sample quality (A260/280 ≈ 2 and A260/230 ≥ 1.8) ...
-
bioRxiv - Physiology 2024Quote: ... After chloroform incubation and centrifugation per manufacture instructions RNA-containing phase was diluted with 70% ethanol 1:1 and RNA isolation was performed using RNeasy Mini Kit (Qiagen). For tissues ...
-
bioRxiv - Physiology 2024Quote: ... Total RNA was isolated using RNeasy Mini Kit (Qiagen) after lysis in RLT buffer with bead homogenization ...
-
bioRxiv - Physiology 2024Quote: ... RNA was isolated using RNeasy Micro Kit (Qiagen GmbH, Hilden, Germany). RNA samples were amplified using the Ovation Pico WTA system V2 (Tecan Genomics ...
-
bioRxiv - Plant Biology 2024Quote: DNA was extracted from young leaf tissue using the Qiagen DNeasy Plant Mini Kit (Qiagen, Germany) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted using the RNeasy® Plus Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The TissueLyser LT (Qiagen PN85600) was used to homogenize the samples for 4 minutes at 50 oscillations per second ...
-
bioRxiv - Neuroscience 2024Quote: ... CeA tissue was prepared for homogenization by placing one stainless steel bead (5mm) (Qiagen, PN69989) inside the tube ...
-
bioRxiv - Neuroscience 2024Quote: ... 300 uL volume of RLT Buffer from the Qiagen RNeasy Kit (Qiagen, PN74104) and 10 uL per mL of Beta-mercaptoethanol was added to each tube ...
-
bioRxiv - Neuroscience 2024Quote: ... kept in RNAlater solution (Qiagen, Madrid), frozen in liquid N2 and stored at −80°C until use ...
-
bioRxiv - Pathology 2024Quote: ... using HotStarTaq DNA Polymerase (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... C3 constructs were purified from the soluble fractions by nickel-based affinity (Ni-NTA, Qiagen). The most concentrated fraction was further purified by size-exclusion chromatography (SEC ...
-
bioRxiv - Plant Biology 2024Quote: ... 250 μL Ni-NTA resin (Qiagen) was equilibrated with 20 column volumes (CV ...
-
bioRxiv - Plant Biology 2024Quote: ... and total RNA was isolated using an RNeasy plant mini kit (Qiagen) following the kit protocol with on-column DNase I digestion (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: ... the BDEVs were resuspended in 10 µL of RTL Lysis Buffer (Qiagen) diluted 1:3 in RNAse-free H2O ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Total RNA was isolated using a RNeasy Mini Kit (Qiagen) and potential DNA contamination was digested with DNase I (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted from MN cultures using the miRNeasy micro kit (Qiagen; Cat#217004) with DNase treatment (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: ... with DNase treatment (Qiagen; Cat#79256) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... nerves were moved from RNAlater to RLT buffer (Qiagen) and minced ...
-
bioRxiv - Neuroscience 2024Quote: ... Total RNA was then extracted using the RNeasy Microkit (74004; Qiagen, Germantown, MD). RNA purity and integrity was assessed via Eukaryote Total RNA Pico Chip (Agilent Technologies ...
-
bioRxiv - Paleontology 2024Quote: ... The DNeasy PowerSoil Pro Kit (Qiagen, Germantown, MD, USA), one of the most common kits for the extraction of DNA from sedimentary environments ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA and DNA were extracted from each SCN sample using the AllPrep DNA/RNA Micro Kit (Qiagen) according to the instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Bacterial DNA was extracted using the QIAamp Powerfecal DNA kit (Qiagen), and its concentration was quantified by Nanodrop 2000 C Spectrophotometer (ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: RNA was purified using the PureLink RNA mini kit with in-column DNAse-I digest (#79254, Qiagen) following the manufacturer’s instructions (#12183018A ...
-
bioRxiv - Neuroscience 2024Quote: ... The total RNA extraction was carried out using the RNeasy Lipid Tissue Mini Kit (Qiagen. The Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: The samples were moved into QIAzol lysis reagent (Qiagen. The Netherlands) and homogenized using a Tissue-Tearor (BioSpec Products ...
-
bioRxiv - Neuroscience 2024Quote: ... Total RNA was isolated using the RNeasy Plus mini kit (QIAGEN #74134) according to the manufacturer’s instructions and processed for sequencing at the Bioinformatics and Expression Analysis core facility at Karolinska Institutet ...
-
bioRxiv - Molecular Biology 2024Quote: ... and organelle fractions using the miRNeasy mini kit (217004; Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... All samples were treated with RNase Free DNase Set (Qiagen. The Netherlands) to remove genomic DNA contamination ...
-
bioRxiv - Molecular Biology 2024Quote: ... or miRCURY LNA RT Kit (339340; Qiagen). PCR was performed using miScript II (218073 ...
-
bioRxiv - Molecular Biology 2024Quote: DNA was isolated from fibroblast cells using the Puregene Kit (Qiagen) according to instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid DNA was isolated using an endotoxin-free maxiprep kit (Qiagen, Germantown, MD). Plasmids were verified by Sanger sequencing (Genewiz ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reaction duplicates were pooled and purified with the QIAquick PCR Purification Kit (Qiagen). Products were sent for targeted re-sequencing on the Illumina MiSeq platform at the NIH Intramural Sequencing Center (https://nisc.nih.gov/index.htm) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplicons purified using the QIAquick PCR Purification Kit (Qiagen) were used to generate gRNA using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... and spun through a RNeasy column from the RNeasy Mini kit (Qiagen) at 8 000 g for 30 s ...
-
bioRxiv - Molecular Biology 2024Quote: ... from genomic DNA (Qiagen blood and tissue kit) using primers BFP_F:atggtgagcaagggcga BFP_R:ggcatggacgagctgtacaag or SNCA_F ...
-
bioRxiv - Neuroscience 2024Quote: RNA was isolated from cell lines using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total DNA was isolated from the dried feces (one fecal sample was ca. 60 mg) using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and purified using a Geneclean Spin Kit (MP-Biomedicals ...
-
bioRxiv - Neuroscience 2024Quote: Differentially expressed genes (DEGs) were annotated by Ingenuity pathway Analysis (IPA; Qiagen) to identify relevant canonical pathways ...
-
bioRxiv - Neuroscience 2024Quote: ... The edited bands were cut from the gel and purified with QIAquick Gel Extraction Kit (Qiagen) for the Sanger sequencing (Azenta).
-
bioRxiv - Neuroscience 2024Quote: ... RNA was isolated from both input and IP samples using RNeasy Mini Kit (Qiagen Cat# 74104).
-
bioRxiv - Molecular Biology 2024Quote: Atrial and vascular tissue was removed and left ventricular myocardium dissected from each heart and homogenized in QIAzol™ reagent (QIAGEN, Maryland, USA). Total RNA containing microRNA was isolated according to manufacturer’s guidelines using miRNeasy spin columns (QIAGEN ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA containing microRNA was isolated according to manufacturer’s guidelines using miRNeasy spin columns (QIAGEN, Maryland, USA). The RNA yield and purity were determined using a NanoDrop ND-1000 (Thermo-Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... Following microRNA extraction using miRNeasy columns (QIAGEN, Maryland, USA), the NCode miRNA First-Strand cDNA Synthesis Kit (Thermo-Fisher ...
-
bioRxiv - Immunology 2024Quote: ... Two PCRs were performed with the PyroMark PCR kit (Qiagen) in order to report the average methylation of 8 representative CpG sites in the regulatory T cell–specific demethylated region (TSDR ...
-
bioRxiv - Immunology 2024Quote: ... with PyroMark Gold Q96 reagents (Qiagen) and Streptavidin Sepharose (GE Healthcare) ...