Labshake search
Citations for Qiagen :
1251 - 1300 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Bacterial pellets were resuspended in Qiagen RLT buffer (Qiagen, Hilden, Germany) supplemented with 1% β-mercaptoethanol ...
-
bioRxiv - Microbiology 2024Quote: ... total RNA was isolated using RNeasy Mini Kit (QIAGEN) from Pa PAO1 cultures grown until mid-log phase in BMM either supplemented with 5 mM CaCl2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... or miRCURY LNA RT Kit (339340; Qiagen). PCR was performed using miScript II (218073 ...
-
bioRxiv - Molecular Biology 2024Quote: DNA was isolated from fibroblast cells using the Puregene Kit (Qiagen) according to instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid DNA was isolated using an endotoxin-free maxiprep kit (Qiagen, Germantown, MD). Plasmids were verified by Sanger sequencing (Genewiz ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reaction duplicates were pooled and purified with the QIAquick PCR Purification Kit (Qiagen). Products were sent for targeted re-sequencing on the Illumina MiSeq platform at the NIH Intramural Sequencing Center (https://nisc.nih.gov/index.htm) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplicons purified using the QIAquick PCR Purification Kit (Qiagen) were used to generate gRNA using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... and spun through a RNeasy column from the RNeasy Mini kit (Qiagen) at 8 000 g for 30 s ...
-
bioRxiv - Molecular Biology 2024Quote: ... from genomic DNA (Qiagen blood and tissue kit) using primers BFP_F:atggtgagcaagggcga BFP_R:ggcatggacgagctgtacaag or SNCA_F ...
-
bioRxiv - Neuroscience 2024Quote: ... containing a Lysis buffer ((RNeasy Micro Kit (Qiagen)) ...
-
bioRxiv - Neuroscience 2024Quote: ... and RNA was extracted using the RNeasy Extraction Kit in accordance with manufacturer’s instructions (Qiagen: 74104). cDNA synthesis was performed using the Reverse Transcriptase Kit (Quantitect ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was extracted from the plant tissues using the RNeasy Plant Mini Kit and Qiagen RNase-Free DNase Set (Qiagen, Hilden, Germany). Three independent RNA samples from each tissue were used for analysis ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was extracted from the proteinase K-digested tail tips of mouse or peripheral blood mononuclear cell (PBMC) of human donors using DNeasy blood tissue kit (Qiagen, #69506). 25 ng of genomic DNA was subjected to bisulfite conversion using a commercial kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were collected and resuspended immediately on RNA protect Bacteria Reagent (QIAGEN) for RNA stabilization ...
-
bioRxiv - Neuroscience 2024Quote: ... The bulk tissue was immediately transferred to lysis buffer of the Rneasy® Micro Kit (Qiagen, 74004) for total RNA extraction ...
-
bioRxiv - Molecular Biology 2024Quote: ... in 96-well plates or a Rotor-Gene Q (Qiagen, Hilden, Germany) in 4-tube strips.
-
bioRxiv - Neuroscience 2024Quote: RNA extraction from hES-iN at D6 of programming was performed with the RNeasy Mini Kit (QIAGEN) following the protocol described by the manufacturer ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthesized from total RNA with QuantiTect Reverse Transcription kit (Qiagen). Quantitative PCR reactions were carried out in triplicate with SYBR Green I Master Mix (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... using TissueLyser LT (Qiagen). If cell cultures were used ...
-
bioRxiv - Neuroscience 2024Quote: ... Heatmaps were generated in Multiple Expression Viewer (MeV) [23].The functional analysis and canonical pathway analysis was generated with Ingenuity Pathway Analysis (IPA, Qiagen, http://www.qiagen.com/Ingenuity) and WEB-based Gene Set Analysis Toolkit (WEBGESTALT ...
-
bioRxiv - Neuroscience 2024Quote: ... Mini-preparations of plasmid constructs were isolated using QIAprep Spin Miniprep Kit (Qiagen). Proceeding sequence confirmation ...
-
bioRxiv - Neuroscience 2024Quote: ... Total RNA was isolated and treated to remove genomic DNA contamination using RNeasy Lipid Tissue Mini Kit (Qiagen, The Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... After homogenization the supernatant was transferred into the extraction columns from RNeasy Micro Kit (Qiagen), and RNA extraction was performed following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteins were purified using Ni2+ affinity chromatography (Ni-NTA Superflow, Qiagen). To purify JetAB complexes containing one full-length and one truncated JetA protomer ...
-
bioRxiv - Microbiology 2024Quote: Reads were aligned to the PA14 reference genome using CLC Genomics Workbench (CLC-Bio/Qiagen) with the following modifications from the standard parameters ...
-
bioRxiv - Microbiology 2024Quote: ... using HiPerFect transfection reagent (Qiagen). Six hours after transfection ...
-
bioRxiv - Microbiology 2024Quote: ... DNA of each isolate was extracted with a commercial kit according to manufacturer instructions (Qiagen) and kept at -20°C before amplification ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted from 250mg edm for the 246 samples (compositional variants and original soils) using the DNeasy PowerSoil-htp 96 well DNA isolation kit (Qiagen, Hilden, Germany). Generation of amplicons for Illumina MiSeq sequencing was done according to a two steps PCR protocol as follows ...
-
bioRxiv - Microbiology 2024Quote: ... or the RNeasy kit (Qiagen, Germany) in accordance with the respective manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2024Quote: An RNeasy kit (Qiagen) was used to purify RNA for RNAseq perturbation and off-target analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted with RNeasy Mini Plus Kit (Qiagen) following supplier’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by purification with the RNeasy Micro kit (QIAGEN, #74004). High-throughput RNA sequencing (RNA-seq ...
-
bioRxiv - Neuroscience 2024Quote: ... and DNA was purified using PCR purification kit (Qiagen). Quantification of the precipitated DNA fragments were performed with real-time PCR using primers listed in Table S4.
-
bioRxiv - Neuroscience 2024Quote: ... gel electrophoresis and subsequent QIAquick™ gel extraction (Qiagen). Linear fragments were then re-ligated using the Rapid DNA Dephosphorylation and Ligation Kit (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissue was homogenized in QIAzol lysis reagent using a TissueLyser LT bead beater (QIAGEN), and RNA was extracted using a QIAGEN RNeasy lipid tissue kit (Cat #74804 ...
-
bioRxiv - Neuroscience 2024Quote: Mechanically-activated currents were measured from N2A-Pz1-KO cells transiently transfected with 500 ng / cDNA construct using Effectene (Qiagen, Cat. Nu. 301425), isolated mouse DRG neurons ...
-
bioRxiv - Neuroscience 2024Quote: ... These cells were transiently transfected plasmids as described below using either Effectene (Qiagen, Cat. Nu. 301425) or PEI-Max (Polysciences Inc ...
-
bioRxiv - Microbiology 2024Quote: ... 2.5 µl of the preparation was used for whole-genome amplification with REPLI-g Single Cell Kit (Qiagen). Subsequently ...
-
bioRxiv - Microbiology 2024Quote: ... the suspended samples were mixed with AHL-buffer and treated with the QIAamp DNA Microbiome Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Homogenization was performed with 2 tungsten beads using a Tissue Lyser (Qiagen, cat# 85300) run at 30 cycles/sec ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted using RNeasy Lipid Tissue Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Total RNA of equal pools of (n = 15) larval brains was extracted using the RNeasy kit (Qiagen). RNA was reverse transcribed to cDNA using the Super Script III First-strand synthesis system (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid was extracted via the QIAfilter plasmid Giga prep kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... a metal ball (Qiagen) and 1mL homogenization buffer (100mM Tris-HCl ...
-
bioRxiv - Neuroscience 2024Quote: dHPC of mice was quickly dissected and RNA was extracted using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) with extra DNase I digestion on the column ...
-
bioRxiv - Neuroscience 2024Quote: ... We used Ingenuity® Pathway Analysis (QIAGEN, Redwood City) software for functional pathway and upstream regulatory analysis (URA ...
-
bioRxiv - Molecular Biology 2024Quote: ... This fraction was then mixed with Ni-NTA agarose beads (Qiagen). Protein-bound Ni-NTA agarose beads were packed into an Econo-column (bio-rad ...
-
bioRxiv - Neuroscience 2024Quote: ... immersed in RNAlater (Qiagen; Hilden, Germany) and stored at -20°C for later analysis ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was isolated from 140 μL of each sample using the Qiagen Viral RNA Mini Kit (Qiagen, Product # 52906) as per the manufacturer’s instructions and stored at −80°C until further analysis.