Labshake search
Citations for Qiagen :
751 - 800 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Microbial DNA was extracted using the DNeasy PowerSoil Pro Kit following the provider’s instructions (Qiagen, Hilden, Germany). DNA samples were sent to the NGS Competence Center Tübingen (Tübingen ...
-
bioRxiv - Microbiology 2024Quote: ... and mapping of the reads on a reference (GenBank strain: U39292) using CLC genomics workbench software v.21.0.5 (Qiagen). Parameters for reference-based assembly consisted of match score = 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were extracted using the QIAamp 96 DNA kit and RNase-Free DNase Set on the automated QIAcube device (both from Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: RNA was extracted with the RNeasy Mini Kit (Qiagen), according to a modified version of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The released genomic DNA was amplified using the REPLI-g Single Cell Kit (QIAGEN) and analyzed by PCR targeting three genes that were polymorphic between the IIdA19G1-GD and IIdA20G1-HLJ isolates ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from the purified oocysts using the Qiagen DNA Mini Kit and amplified using the REPLI-g Midi Kit (QIAGEN). WGA products were purified using the EasyPure PCR Purification Kit (TransGen Biotech ...
-
bioRxiv - Microbiology 2024Quote: ... Ribosomal RNA was removed using QIAseq FastSelect –5S/16S/23S kit (Qiagen). Sequencing libraries were prepared with the KAPA Stranded RNA-Seq Library Preparation Kit (Kapa Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... The RNeasy Mini Kit (Qiagen) was used to extract and purify RNA from the cell pellets per vendor protocol ...
-
bioRxiv - Microbiology 2024Quote: ... including on-columns RNase-Free DNase treatment (Qiagen) for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... the DPBS resuspended virion pellet was treated with RNase free DNase Set (Qiagen, Cat. No. 79254) which was neutralized with 10mM Ethylenediamine Tetra-acetic Acid (EDTA ...
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was extracted using the DNeasy Blood and Tissue kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DNA isolation was then performed using DNeasy Blood and Tissue Kit (Qiagen, Cat. No. 69506) following the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2024Quote: ... RNeasy mini kits (Qiagen, 74104) were used ...
-
bioRxiv - Molecular Biology 2024Quote: ... SI03146479 and All Stars negative control SI03650318 siRNAs were from Qiagen. siRNA was transfected with lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: The AllPrep DNA/RNA Micro kit was used to prepare HIO RNA (Qiagen, Germantown, MD). SuperScript IV VILO Master Mix was used to prepare cDNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lysate was spun down at 14,000g for 30 min and supernatant was applied to Ni-NTA fast kit columns (Qiagen, 30600). Protein was washed with 16 mL buffer B (20 mM Hepes pH 7.3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequences of all constructs were verified by Sanger sequencing (Macrogen) and plasmids were purified prior to use (Midi plasmid kit, QIAGEN).
-
bioRxiv - Molecular Biology 2024Quote: ... The top phase was then purified using the MinElute kit (Qiagen), eluting in 50 uL 55°C EB buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The analysis was performed on Rotor-Gene 6000 thermal cycler (Corbett, QIAGEN, Hilden, Germany). The gene expression data were analysed by using Rotor-Gene 6000 Software (QIAGEN) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I (AppliChem) and 200 µg/mL RNase A (Qiagen) using 4 cycles of 15 s sonification at 30% duty cycle and 30% output control ...
-
bioRxiv - Microbiology 2024Quote: ... In samples processed by Qiagen extraction method ...
-
bioRxiv - Microbiology 2024Quote: ... total DNA was isolated by using the DNeasy blood and tissue kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The pooled amplified cDNA was cleaned up with 0.6x AMPure XP or SPRIselect beads and taken up in 50μl 5x diluted Elution Buffer (EB; Qiagen) in nuclease-free water (Thermo Fisher).
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I and 200 µg/mL RNase A (Qiagen). Followed by a mild sonication (10 strokes ...
-
bioRxiv - Molecular Biology 2024Quote: ... After DNase I (Qiagen) treatment ...
-
bioRxiv - Molecular Biology 2024Quote: ... StrepTactin sepharose or Ni-NTA agarose (Qiagen). 2S-GST ...
-
bioRxiv - Molecular Biology 2024Quote: RNAs were isolated using RNeasy Plus RNA isolation kit (Qiagen) and additionally purified of DNA contamination using DNA-free kit (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2024Quote: ... CCGGTTAGTGTTCGGGTGAAA (Qiagen, no. SI00912772).
-
bioRxiv - Cell Biology 2024Quote: ... AATTCTCCGAACGTGTCACGT (Qiagen, no. 1027281); Inf2 ...
-
bioRxiv - Cell Biology 2024Quote: ... CACGTAGAACTCCCTGCATAA (Qiagen, no. SI00912765); Sun2 #2 ...
-
bioRxiv - Cell Biology 2024Quote: ... TAGGCTCTAGGGAACAAATAA (Qiagen, no. SI00822031); Sun2 #1 ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted from oocysts of transgenic parasites using the QIAGEN DNeasy Blood and Tissue Kit (QIAGEN, Germany). PCR primers were designed to anneal outside the 5′ and 3′ homology arms directing homologous recombination ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were transfected using Lullaby transfection reagent according to the manufacturer’s instructions with a pool of 10 nM of Mus musculus Rab6ip siRNA (2.5 nM each) or a matched concentration of control scramble siRNA (AllStars Negative siRNA, Qiagen; 1027281). The knockdown efficiency of ERC1 was determined by Western blotting using Mouse anti-ELKS antibody (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... or FlexiGene DNA Kit (Qiagen, 51206). Unmethylated lambda DNA (Promega ...
-
bioRxiv - Cell Biology 2024Quote: RNeasy Plus mini kit (Qiagen, 74134) was employed to extract the RNA according to the manufacturer’s instructions and then quantified using a NanoDrop spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantinova Reverse Transcription Kit (Qiagen, 205413) was used according to the manufacturer’s instructions to transcribe the RNA to cDNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... including the DNase I (Qiagen; 79254) treatment ...
-
bioRxiv - Developmental Biology 2024Quote: RNA was isolated using the RNeasy Mini Kit (Qiagen; 74104) including the DNase I (Qiagen ...
-
bioRxiv - Developmental Biology 2024Quote: ... plasmids were purified from positively screened colonies with QIAprep Miniprep Kit (QIAGEN) and sequenced at the Research Institute for Molecular Genetics of Kochi University ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was isolated from macrophages using the Qiagen AllPrep RNA/DNA Micro Kit (Qiagen, Germantown, MD). The macrophage global pattern of gene expression was determined using RNASeq on the Illumina platform.8 Reads were quantified by kallisto using Gencode v24 as the reference genome ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: Total cellular RNA was extracted from cells with a RNeasy Micro Extraction Kit (QIAGEN). Reverse transcriptase reactions were performed using an iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmids were isolated from cultures using the QIAprep Spin Miniprep Kit (Qiagen, 27104).
-
bioRxiv - Molecular Biology 2024Quote: ... RNA samples were isolated using AllPrep DNA/RNA Mini Kit (QIAGEN 80204). RNA libraries were prepared using KAPA RNA HyperPrep Kit with RiboErase (HRM ...
-
bioRxiv - Molecular Biology 2024Quote: We harvested 20,000 cells per condition in duplicate into buffer RLT (Qiagen). We then extracted nucleic acid using Dynabeads MyOne Silane beads (Thermo Fisher) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and RNAse-free DNase Set (Qiagen #79254). RNA quality was determined by measuring the RNA integrity number (RIN ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted from 0.25 g of sponge tissue using the DNeasy PowerSoil Kit (Qiagen, Hilden, Germany) using the optimized procedure of Marotz et al ...
-
bioRxiv - Microbiology 2024Quote: ... spongiae DNA was extracted from mouse tissues using DNAeasy Blood and Tissue kit (Qiagen). The numbers of mice used in each individual experiment were calculated to permit detection of at least a two- to four-fold difference in bacterial loads between groups with 95% (two-sided ...
-
bioRxiv - Microbiology 2024Quote: ... 100μl of each sample was inactivated in a S-Block (Qiagen) loaded with VXL lysis buffer containing RNA carrier and proteinase K ...
-
bioRxiv - Molecular Biology 2024Quote: ... The amplified DNA was purified with a QIAquick PCR Purification Kit (Qiagen) per the manufacturer’s instructions and inspected on a 0.8% agarose ...
-
bioRxiv - Cell Biology 2024Quote: ... excised and purified using the QIAquick Gel Extraction Kit (#28706, QIAGEN, Germany). Half of the DNA was methylated in vitro with the CpG methyltransferase M.SssI (M0226L ...