Labshake search
Citations for Qiagen :
1 - 50 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... We then treated samples with 25 µl of Proteinase K (Qiagen 19131) and incubated for an additional 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... We performed on-column DNase digestion using the RNase-Free DNase Set (Qiagen 79254). We eluted samples in RNase-free water according to the manufacturer’s instructions and stored recovered RNA at −80°C until library preparation ...
-
bioRxiv - Microbiology 2024Quote: ... 300 µL of Ni-NTA resin slurry (Qiagen) was washed with 10 mL of wash buffer (25 mM Tris-HCl pH 8.0 ...
-
Hepatitis B Virus genomes associate with cellular sites of DNA damage by inducing replication stressbioRxiv - Microbiology 2024Quote: ... isopropanol precipitation and using a PCR Purification kit (Qiagen). 3C DNA was eluted in 200 μL of DNA ...
-
Hepatitis B Virus genomes associate with cellular sites of DNA damage by inducing replication stressbioRxiv - Microbiology 2024Quote: ... purified using the PCR purification kit (Qiagen) and sequencing libraries were prepared using the NEB Ultra Kit ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid was extracted from each sample using the QIAprep Spin Miniprep Kit (Qiagen) following manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... The cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was purified from the blood of a transfer mouse using the Qiagen QIAamp DNA Blood Kit (Qiagen, Cat# 51106), and genotyping PCR was performed to assess integration into the target locus ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA copy number in a small aliquot of each sample was measured on a QIAcuity digital PCR (dPCR) system (Qiagen) using forward primer ACGTGGTGTTTATTACCCTGACA ...
-
bioRxiv - Microbiology 2024Quote: ... or QIAprep Spin Miniprep Kit (QIAGEN). For GFP2 and GFP4 vectors successfully cloned enhancer constructs were further isolated with ZymoPure II Maxiprep kit (Zymo research).
-
bioRxiv - Microbiology 2024Quote: ... the DNA was isolated with the EZ1 DNA Tissue kit on the BioRobot EZ1 robot (Qiagen, Hombrechtikon, Switzerland).
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and resuspended in 100 μl ...
-
bioRxiv - Microbiology 2024Quote: ... His-tag-affinity chromatography-purifcation was performed with a Ni-NTA agarose (Qiagen, Hilden, Germany) gravity flow column ...
-
bioRxiv - Immunology 2024Quote: ... the RLT Plus Buffer (Qiagen®) with 1% βmercapto-ethanol and the included cells were further processed for library preparation ...
-
bioRxiv - Immunology 2024Quote: Primary astrocytes were lysed in Buffer RLT (Qiagen) and RNA was isolated from cultured astrocytes using the Qiagen RNeasy Mini kit (Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... Ingenuity Pathway Analysis software (Qiagen) was used by inputting gene expression datasets with corresponding log (FoldChange ...
-
bioRxiv - Immunology 2024Quote: ... and RNA was isolated from cultured astrocytes using the Qiagen RNeasy Mini kit (Qiagen, #74106). cDNA was transcribed using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA samples underwent treatment with the RNase-Free DNase set from QIAGEN. The purified RNA was ultimately resuspended in RNase-Free Water (QIAGEN) ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was purified using the RNeasy Mini Kit (QIAGEN) with the RNA protect Bacteria reagents (QIAGEN) ...
-
bioRxiv - Microbiology 2024Quote: ... purified via QIAQuick PCR purification kit (Qiagen), and pET28a vector ...
-
bioRxiv - Immunology 2024Quote: ... or RNeasy Mini Kit (Qiagen) and following the manufacturer protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and RNeasy Mini Kit (Qiagen, #74106). Total RNA concentration and RNA integrity number was determined using a Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was extracted from cell lines using the DNeasy Blood & Tissue Kits (Qiagen, Hilden, Germany) and amplified using the strategy described by Moyes et al ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was isolated using RNeasy Plus Micro Kit (Qiagen), and first-strand cDNA was prepared using an AMV RNA PCR kit (TaKaRa ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription and quantitative real-time PCR were performed with the QuantiFast SYBR Green PCR Kit (Qiagen, Hilden, Germany). Since the endogenous retrovirus envelope comprises only one exon ...
-
bioRxiv - Cancer Biology 2024Quote: ... The immunoprecipitated DNA was purified using QIAquick PCR or Mini-Elute PCR purification kits (Qiagen) and analyzed by massive parallel sequencing or quantitative real-time PCR assay.
-
bioRxiv - Cancer Biology 2024Quote: ... RNase A (25 µg/mL final concentration; Qiagen, 19101) was added ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was isolated using the QIAquick Gel Extraction Kit (Qiagen, 28704). DNA was sequenced by next-generation sequencing at the Biopolymers Facility at Harvard Medical School (NextSeq 500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... miRCURY LNA SYBR® Green PCR Kit (Qiagen) was used for QRT-PCR according to manufacturer instructions and as described in (5).
-
bioRxiv - Cancer Biology 2024Quote: ... For two-way qPCR (analysis of MAPK11; Hs_MAPK11_1_SG QuantiTect Primer Assay, Qiagen); cDNA was first synthesised with High Capacity cDNA Reverse Transcription Kit (Fisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... according to the manufacturer’s protocol (RNeasy® Mini – Qiagen). For one-way qPCR (analysis of MAP3K1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... For one-way qPCR (analysis of MAP3K1, Hs_MAP3K1_1_SG QuantiTect Primer Assay, Qiagen); Luna® Universal One-Step RT-qPCR Kit was used ...
-
bioRxiv - Cancer Biology 2024Quote: ... loading master mix containing 5µl QuantiNova SYBR® Green PCR Kit (Qiagen) master mix ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tumour samples were fresh-frozen in liquid nitrogen and stored at -80°C for protein isolation or preserved in RNAlater solution (Qiagen) for RNA isolation ...
-
bioRxiv - Cancer Biology 2024Quote: The RNeasy Mini Kit (Qiagen, Hilden, Germany) was used for the extraction of total RNA from cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... the clarified lysate was diluted into 1x Ni-NTA binding buffer and bound to equilibrated Ni-NTA resin (Qiagen, 30210) for 20 minutes at 4°C with end-over-end mixing ...
-
bioRxiv - Cancer Biology 2024Quote: rEDA was produced intracellularly using the pQE-30 His tag purification system (Qiagen) in E ...
-
bioRxiv - Cancer Biology 2024Quote: ... and rEDA was purified using nickel-nitrilotriacetic acid-agarose resin (Qiagen).
-
bioRxiv - Cancer Biology 2024Quote: ... The transposition mixtures were quenched with 500 μl PB buffer (Qiagen) and purified by standard protocol with the MinElute PCR purification kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was then purified using the RNeasy Mini Kit (Qiagen) with on-column DNase digestion ...
-
bioRxiv - Cancer Biology 2024Quote: Differentially expressed gene sets were analyzed using Ingenuity Pathway Analysis Software (Qiagen). Gene sets were uploaded into IPA for Core Expression Analysis of expression data ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted using the RNeasy Mini Kit according to the manufacturer’s protocol and treated with DNase (Qiagen, Valencia, CA USA). cDNA was prepared with the Fermentas cDNA synthesis kit according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Pellets were processed using Qiagen DNeasy Blood and Tissue Kit according to manufacturers’ protocol (Qiagen, catalog 69504). DNA was eluted in Qiagen Buffer AE and frozen at -20°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Cancer Biology 2024Quote: ... Lysed samples were processed using Qiagen RNeasy Micro Kit according to manufacturers’ protocol (Qiagen, catalog 74004). RNA was eluted in RNase-free water and frozen at -80°C until RNA could be assessed for quality ...
-
bioRxiv - Cancer Biology 2024Quote: An aliquot of recovered cells was lysed in RLT buffer (Qiagen) and 10% beta-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lysis buffer was comprised of RLT Buffer (Qiagen) and 10% beta-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted from PDX4 SE and PDX4 CR cells using the miRNeasy Mini Kit (217004, Qiagen). Before sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR purification was carried out using MinElute PCR Purification Kit (Qiagen, 28004) to remove remaining primers and large fragments ...