Labshake search
Citations for Promega :
4051 - 4100 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... mass spectrometry grade trypsin (Promega Gold) was added at 1:40 w/w and the digestion were let to proceed at 37°C overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... The expression of the NLuc-fusion proteins was initiated by washing out Dox and changing the medium into CDMi containing protected furimazine (Promega). After the NLuc signal was confirmed 4-5 hours later ...
-
bioRxiv - Developmental Biology 2024Quote: See (60) for detailed LipoGlo methods and reagents (Promega Corp., N1110; (106)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing 10 U/mL DNase (Promega, #M6101) for 1 hour at 4°C with agitation ...
-
bioRxiv - Developmental Biology 2024Quote: ... Each RNA sample was reverse-transcribed with the GoScript Reverse Transcription system (A5001, Promega) using Oligo(dT ...
-
bioRxiv - Developmental Biology 2024Quote: ... Luciferase intensity was measured by the Luciferase Assay System kit (Cat #, E1500; Promega, Madison, WI) on Promega GloMax Explorer (Cat # ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA template was converted to cDNA using M-MLV-Reverse Transcriptase (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1U/mL RNAse inhibitor (#N2515, Promega). CPN GCs at P1 were collected from the corpus callosum in the ipsilateral cortical hemisphere ...
-
bioRxiv - Microbiology 2024Quote: NADH/NAD+ and NADPH/NADP+ ratios were measured using the Bioluminescent NAD/NADH-Glo detection kit (Promega) and NADP/NADPH-Glo detection kit (Promega) ...
-
bioRxiv - Microbiology 2024Quote: ... and NADP/NADPH-Glo detection kit (Promega), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... The light emission was continuously recorded on a GloMax microplate luminometer (Promega) in three biological replicas ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantification was performed using Renilla glow (Promega: #G9681) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2024Quote: ... NanoGlo lytic detecton system was obtained from Promega (N3030). Triton X-100 was obtained from Sigma-Aldrich (X100-100ML) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The cell pellet was collected for genomic DNA purification using a Wizard Genomic DNA Purification Kit (Promega) under the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... proteins were alkylated in 5 mM iodoacetamide for 1 hour in the darkness at RT and digested overnight at 37°C with 1 µg trypsin (Trypsin Gold Mass Spectrometry Grade, Promega). Peptides were recovered by centrifugation ...
-
bioRxiv - Cell Biology 2024Quote: ... PEG 8000 (Polyethylene glycol 8000) was purchased from Promega (Catalog #: V3011). Amine-reactive PEG (mPEG-succinimidyl valerate MW 5000 ...
-
bioRxiv - Neuroscience 2024Quote: ... 12.5 µl 40 U/ µl RNasin (Promega Cat# N2615), 10 µl protease and phosphatase inhibitor cocktail (100X ...
-
bioRxiv - Immunology 2024Quote: ... LDH release was assessed using the Cytotoxicity Detection Kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The ATP concentration was measured using the BacTiter-Glo™ Microbial Cell Viability Assay (Promega, Belgium) and luminescence was measured with the Infinite M Plex ...
-
bioRxiv - Microbiology 2024Quote: ... the OD600 was recorded and the cultures were used for the Nano-Glo Luciferase assay (Promega, Madison, WI). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... In-solution digestion was performed overnight on a shaker set at 37 °C using sequencing grade trypsin (Promega, Madison, WI) at ∼1:25 w/w enzyme/protein ratio ...
-
bioRxiv - Microbiology 2024Quote: ... and the protein solution was digested with trypsin (Promega) overnight at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... Extracted DNA was used to template PCR reactions with GoTaq polymerase (Promega #M3001) to amplify ITS (primers emITS-1:TGGTAGAGAATGATGGCTGTTG and emITS-4:GCCTCTATGCCTAATTGCCTTT ...
-
bioRxiv - Microbiology 2024Quote: Intracellular ATP levels were determined using the BacTiter-Glo Microbial Cell Viability Assay (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: DNA from cell cultures was isolated using ReliaPrep gDNA Tissue Miniprep System (Promega, A2052). Samples were processed by the Global Screening Array (GSA ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR reactions were ligated into a pGEM T-Easy plasmid (Promega). Closed inserts were Sanger sequenced by the UChicago Comprehensive Cancer Center DNA Sequencing Facility ...
-
bioRxiv - Physiology 2024Quote: ... or TUNEL (Promega, Indianapolis, IN), respectively ...
-
bioRxiv - Physiology 2024Quote: ... TUNEL (Promega, Indianapolis, IN) and 4’,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Neuroscience 2024Quote: ... a solution containing 25 µg/mL of sequencing grade trypsin (Promega, USA) diluted in 20 mM ammonium bicarbonate (Thermo Fisher ...
-
bioRxiv - Immunology 2024Quote: ... 1 uL of IdeS (40 units/uL, Promega) was added to the antibody solution and incubated at 37°C for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative RTLPCR was performed using a OneTaq RTLPCR kit (Promega, M0482S) with qTOWER3 (Analytik Jena) ...
-
bioRxiv - Immunology 2024Quote: ... and ligation by T4 DNA ligase (Promega Corporation). TSP-4 cDNA was amplified from pRP[Exp]-mCherry/Neo-CAG>hTHBS4[NM_003248.6] (ID VB900137-1200xfw ...
-
bioRxiv - Immunology 2024Quote: ... and ligation by T4 DNA ligase (Promega Corporation). The constructs were confirmed by sequencing.
-
bioRxiv - Immunology 2024Quote: ... and ligated by T4 DNA ligase (Promega Corporation). Human TSP-4 cDNA was amplified from pRP[Exp]-mCherry/Neo-CAG>hTHBS4[NM_003248.6] (ID VB900137-1200xfw ...
-
bioRxiv - Neuroscience 2024Quote: ... stable cell line expressing the human MC4-R and a split luciferase cAMP genetic sensor based on the circularized fusion of firefly luciferase and protein kinase A regulatory cAMP binding domain (clone 22F, Promega, Madison WI) was used to determine the α-MSH-elicited cAMP responses in live cells as previously described 32 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 25 μL per well Bright-Glo reagent (Promega Corporation, Cat No. E2620) was added ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were lysed using RNA Lysis Buffer of SV Total RNA Isolation System (Promega, Madison, WI) for RNA quantification.
-
bioRxiv - Molecular Biology 2024Quote: ... total RNA was extracted from BHK-21 cells transfected with viral genomic RNAs by using the SV Total RNA Isolation System (Promega, Madison, WI) based on the user’s manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... total RNA was treated with DNase I (Promega) and subjected to reverse transcription using RevertAid Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... After incubation with 646-Janelia Fluor® HaloTag® Ligand (Promega, #GA1120), cells were sorted by FACSAria III for both mCherry positive fluorescence at 587 nm excitation ...
-
bioRxiv - Cancer Biology 2024Quote: Purified rRNA (1 to 3 µg) was digested overnight at 37 °C with 270 units of Nuclease S1 (Promega) using the supplied buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 hours after bizine treatment cells were exposed to 250μM or 500μM hydrogen peroxide for 2 min after which glutathione (GSH) levels in cells were assayed according to the manufacturer’s instructions for GSH-Glo™ Glutathione Assay (Promega, Madison, WI, USA).
-
bioRxiv - Immunology 2024Quote: ... Then reverse transcribed to cDNA using a GoSript Reverse Transcription kit (Promega). Real-time PCR was performed using SYBR Green Realtime PCR Master Mix (TOYOBO ...
-
bioRxiv - Immunology 2024Quote: ... and random primers (Promega C118A) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The proteins were then treated with 0.25 μg Trypsin/LysC (Promega, #V5072), while shaking at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... first-strand cDNA was synthesized from RNA with Reverse Transcription System Kit (Promega). Subsequently ...
-
bioRxiv - Molecular Biology 2024Quote: ... the sample was incubated with sequence grade chymotrypsin (Promega) at 37°C for 18 hours ...
-
bioRxiv - Immunology 2024Quote: ... cDNA was synthesized using the GoScript Reverse Transcription System (Promega) and quantitative real-time PCR was conducted as described previously (40).
-
bioRxiv - Molecular Biology 2024Quote: ... Seventy micrograms of protein were digested overnight using the filter-aided sample preparation (FASP) method 23 with Trypsin/Lys-C mix (Promega, Madison, WI, USA) (enzyme-to-protein ratio 1:35 ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was isolated from RLBP1-containing pGEM-T easy colonies and digested with MluI and XhoI (Promega) for 3 h at 37 °C ...