Labshake search
Citations for Promega :
251 - 300 of 1059 citations for Two Hybrid cDNA Library since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Libraries were quantified in a Quantifluor (Agilent Quantus Fluorometer, Promega) using QuantiFluor ONE dsDNA kit (Promega ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... cDNA was prepared from RNA samples with GoScript reverse transcriptase (Promega) according to manufacture instructions ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized with the M-MLV reverse-transcriptase kit (Promega) and diluted 1 in 5 before further application ...
-
bioRxiv - Genetics 2021Quote: ... 1 μL of cDNA was mixed with Red Taq 2x (Promega), and 0,25 μM of universal reverse primer (complementary to the stem loop one ...
-
bioRxiv - Cell Biology 2020Quote: ... and cDNA synthesis was performed with M-MLV Reverse Transcriptase (Promega) for 1 h at 42°C ...
-
bioRxiv - Immunology 2021Quote: ... The corresponding cDNA was subcloned into pGL3 basic (Promega, no. E1751) upstream to sequence encoding redfirefly luciferase ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was then synthesized using the reverse transcription kit from Promega. Transcriptional levels of PD-L1 (Forward ...
-
bioRxiv - Genomics 2020Quote: Total RNA was reverse transcribed to cDNA using random primers (Promega) and M-MLV Reverse Transcriptase RNase H (Promega) ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA was synthesized using the ImProm-II Reverse Transcription System (Promega). Taqman probes used for qPCR are listed in Supplemental Table 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by cDNA synthesis using GoScript Reverse transcription mix (Promega, USA). SpCas9 expression was detected with primers chCas9_F1 (5’- GAGAGAATGAAGCGGATCGAAGAG - 3’ ...
-
bioRxiv - Biophysics 2019Quote: ... cDNA was transcribed from RNA (Reverse Transcriptase kit, Promega, Madison, USA) using Reverse Transcriptase (Roche ...
-
bioRxiv - Genetics 2019Quote: ... and cDNA synthesis (M-MLV RT kit, Promega Corporation, cat. #M170A) were performed according to manufacturer’s specifications [21] ...
-
A general role of zinc binding domain revealed by structures of σ28-dependent transcribing complexesbioRxiv - Molecular Biology 2020Quote: ... RNA was first reverse transcribed to cDNA using M-MLV (Promega). The relative amount of target mRNA was analyzed by quantitative RT-PCR (qRT-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Reverse transcription was performed with an RT cDNA Synthesis Kit (Promega). Real-time PCR was performed with SYBR green SuperMix using an iCycler real-time PCR detection system (Bio-Rad).
-
bioRxiv - Biochemistry 2020Quote: ... cDNA was generated using the ImProm-II Reverse Transcriptase System (Promega) with 300 ng RNA per reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... This cDNA was then subcloned into pCI-neo (Promega, Madison, WI) and verified by sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA synthesis was performed using the AMV Reverse Transcription System (Promega), with a combination of oligo (dT ...
-
bioRxiv - Genomics 2020Quote: ... and cDNA synthesis was performed with M-MLV Reverse Transcriptase (Promega) for 1h at 42°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Retrotranscription into cDNA was performed using M-MLV Reverse Transcriptase (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNAs were amplified by 15 PCR using GoTaq G2 polymerase (Promega) and TruSeq_adaptor_fwd and TruSeq_adaptor_rev primers (Table S1) ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was synthesized using the reverse transcription system (Promega, Madison, USA) as described previously (Veeck et al ...
-
bioRxiv - Microbiology 2020Quote: ... and cDNA was synthesized using GoScript™ Reverse Transcriptase System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized using the ImProm-II Reverse Transcription System (Promega). Gene expression master mix (Applied Biosystems 4369016 ...
-
bioRxiv - Microbiology 2021Quote: ... we amplified DNA and cDNA using GoTaq® DNA polymerase (Promega) under the following conditions ...
-
bioRxiv - Neuroscience 2021Quote: ... and converted to cDNA using the Promega Reverse Transcription system (Promega). SYBR green qRT-PCR was performed in triplicate using cDNA and run on Bio-Rad CFX384 real time thermocycler ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was generated using the ImProm-II Reverse Transcriptase System (Promega) or SuperScript IV Reverse Transcriptase System (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was then obtained using a MMLV reverse transcriptase (Promega, location). qPCR analysis was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA amplification was performed using Go-Taq flexi DNA polymerase (Promega). PCR products were then applied to 1% agarose gel.
-
bioRxiv - Cell Biology 2020Quote: ... and reverse transcribed into cDNA using the Reverse Transcription System (Promega) according to the manufacturer‟s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... cDNA was synthesized using ImProm-II Reverse Transcription System (Promega-A3800). Quantitative real-time PCR (qPCR ...
-
bioRxiv - Immunology 2020Quote: ... 10ng of cDNA was used per reaction with Syber Green (Promega). All the primers (described in Table 1 ...
-
bioRxiv - Plant Biology 2019Quote: ... and cDNA was synthesized using the GoScript Reverse Transcription System (Promega). Gene expression was quantified using a light cycle real-time PCR detection system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cDNA was cloned into the pGEM-T easy vector (Promega) and sequenced to confirm identity ...
-
bioRxiv - Genetics 2019Quote: ... transcribed mRNA into cDNA using M-MLV Reverse Transcriptase (Promega, Germany), and checked the effect on the psmc3 splice sites by RT-PCR using the amplification conditions as described before (Figure S14B).(Müller et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was transcribed into cDNA using an oligo dTn primer (Promega) per reaction ...
-
bioRxiv - Microbiology 2021Quote: ... and amplified the resulting cDNA with GoTaq® DNA polymerase (Promega) under the following conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized using M-MLV reverse transcriptase (Promega, Mannheim, Germany). Reverse transcription qPCR (RT-qPCR ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was converted to cDNA using AMV reverse transcriptase (Promega) using an oligo dT primer using the Promega supplied protocol and reaction buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was transcribed into cDNA using an oligo dTn primer (Promega) per reaction ...
-
bioRxiv - Genomics 2020Quote: ... The cDNAs were subsequently purified with ProNex magnetic beads (Promega, WI) following the instructions in the Iso-Seq Express Template Preparation for Sequel and Sequel II Systems protocol (Pacific Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized with the M-MLV reverse-transcriptase kit (Promega) and diluted 1 in 5 before further application ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was synthesized with Reverse Transcriptase (Promega, San Luis Obispo, CA) and used for RT-PCR ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was prepared from RNA samples with GoScript reverse transcriptase (Promega) according to manufacturer instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was reverse transcribed with M-MuLV reverse transcriptase (Promega, USA). The qRT-PCR analysis was performed on an Applied Biosystems Fast7500 device using Fast SYBRGreen Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: cDNA was generated using the ImProm-II Reverse Transcription System (Promega) by adding 1 μL of random hexamers to a total of 1 μg of extracted total RNA and incubated at 70°C for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and converted to cDNA using the Promega Reverse Transcription system (Promega). SYBR green qRT-PCR was performed in triplicate using cDNA and run on the Bio-Rad CFX384 real time thermocycler ...
-
bioRxiv - Microbiology 2022Quote: ... treatment and cDNA was synthesized using M-MLV RT (Promega, USA). Gene specific primers used (Table 4) ...
-
bioRxiv - Physiology 2022Quote: ... The cDNA was prepared using MMLV reverse transcriptase (Promega, Madison, WI) using 500 ng of total RNA per reaction ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized using a MMLV reverse transcriptase (Promega, Madison, WI). Real-time PCR was performed using Radiant qPCR mastermix (Alkali Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cDNA was synthesized using the GoScript reverse transcriptase system (Promega). qRT-PCR was performed with GoTaq qPCR Master Mix (Promega ...