Labshake search
Citations for Promega :
151 - 200 of 1059 citations for Two Hybrid cDNA Library since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was generated by MMLV reverse transcription (Promega Germany). Quantitative Real Time PCR assays were carried out by using QuantStudio 5 (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesised (AMV Reverse Transcriptase kit, Promega, Southampton, UK) and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using the reverse transcription kit (Promega) and transcriptional expression of IFIT1 (Fw ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was done with reverse transcription kit (Promega) using 50ng of total RNA ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized with M-MLV retro-transcriptase (Promega) and random hexamers primers (Invitrogen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis was performed using random primers (Promega, C1181) and M-MLV Reverse Transcriptase RNase H (Solis BioDyne ...
-
bioRxiv - Microbiology 2021Quote: ... we synthesized cDNA using M-MLV reverse transcriptase (Promega) and random hexamers from either 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... A cDNA encoding human KIF1A was purchased from Promega Japan (Promega Japan ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was synthesized using a reverse-transcription system (Promega). Real-time RT-PCR was performed with the ABI-7500 System ...
-
bioRxiv - Molecular Biology 2019Quote: ... then cDNA was synthesized using AMV reverse transcriptase (Promega). The cDNA was used for qPCR analysis using iTaq Universal SYBR Green Supermix (BioRad ...
-
bioRxiv - Physiology 2019Quote: ... cDNA was synthesized using a Reverse Transcriptase kit (Promega). Quantitative real-time PCR was conducted using primer sets in Supplementary Table 1 and mRNA levels were analyzed in duplicate using SYBR green (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesized using GoScript Reverse Transcription system (Promega), and qPCR was executed using QuantiNova SYBR Green PCR Kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... cDNA synthesis was performed using MMLV-reverse transcriptase (Promega), reactions contained either 500 ng or 1000 ng RNA (dependent on the lowest RNA yield in a tissue cohort for consistency ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized using Reverse Transcription System (Promega, A3500) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... after CDNA synthesis by the MMLV Reverse Transcriptase (Promega). The CFX96 Touch Real-Time PCR Detection System (Biorad ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We synthesised cDNA with M-MVL reverse transcriptase (Promega) and random hexamer primers (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA was obtained using GoScript Reverse System (Promega) from 200 ng RNA ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was produced using GoScript Reverse Transcriptase (Promega, A5004) and a quantitative PCR was performed using SensiFast SYBR (Bioline ...
-
bioRxiv - Plant Biology 2023Quote: ... and cDNA was synthesized using ImpromII Reverse Transcriptase (Promega). SlSBP3 (Solyc10g009080 ...
-
bioRxiv - Immunology 2023Quote: ... and cDNA was synthesized using MMLV Reverse Transcriptase (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... miniata cDNA and cloned into pGEM-T Easy (Promega). Inserts were PCR amplified using M13 primers and template plasmid was digested with DpnI before PCR purification (Qiagen) ...
-
bioRxiv - Immunology 2024Quote: ... and directly used for cDNA synthesis (Promega GmbH, Germany). qRT-PCR was performed for AhR ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were diluted two-fold again and incubated overnight at 37 °C with trypsin (sequencing grade modified, Promega) at a 1:50 (w/w ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were diluted two-fold with 20 mM HEPES pH 8.0 and proteins digested with Lys-C (Promega) at a protease/protein ratio of 1:100 (w/w ...
-
bioRxiv - Microbiology 2021Quote: ATPase activity of the purified proteins was determined using two kits – Enliten ATPase assay (FF2000, Promega, Moscow, Russia) and malachite green phosphate assay (MAK307 ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was measured two days post treatment with CellTiter-Glo Luminescent Cell Viability Assay kit (Promega, G7570) following standard protocol ...
-
bioRxiv - Biophysics 2022Quote: ... and the two halves were digested with either Sequencing Grade Modified Trypsin or endoproteinase Glu-C (both Promega, Madison ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The two plasmids were transfected at a ratio of 20 ng:20 ng per well using ViaFect (Promega), employing a transfection agent to plasmid ratio of 3:1 μL:μg.
-
bioRxiv - Neuroscience 2023Quote: ... 2018) resulting in two fractions after sequential proteolysis with first Lys-C (Wako Chemicals) followed by trypsin (Promega). Peptides were analyzed on a Q Exactive HF mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... We employed a two-step digestion process (involving lysyl endopeptidase, from FUJIFILM Wako Chemicals U.S.A. Corporation, followed by trypsin, Promega) in-solution to produce the crosslinked peptide pairs.
-
bioRxiv - Systems Biology 2020Quote: ... The pooled library was miniprepped (Promega, Madison, WI, USA) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... the library was quantified by QuantiFluor ssDNA System (Promega). Sequencing of the prepared DNB was conducted using the MGIseq system (MGI ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library was quantified (QuantiFluor® dsDNA System; Promega #E2670) before being pooled (10 fmol per sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... or by qPCR (ProNex NGS Library Quant Kit, Promega). DNA libraries were sequenced on Illumina NextSeq 500 or Illumina MiSeq platforms.
-
bioRxiv - Genomics 2021Quote: ... Barcoded and amplified cDNAs were purified using ProNex beads (Promega), following the workflow targeting transcripts around 2 kb in length ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNAs were converted into cDNA using GoScript RTase (Promega) random hexamer primers for 60 min at 42 °C according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using the M-MLV Reverse Transcriptase (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cDNA was synthesized using GoScript Reverse Transcriptase system (Promega). qRT-PCR was performed with Taqman Gene Expression (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... cDNA was prepared using Promega kit (REF 017319, Promega, USA). Primers were designed according to the sequence information from the NCBI database using Primer3 Input (version V ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was then synthesized using AMV reverse transcriptase kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA synthesis was performed with M-MLV reverse transcriptase (Promega) using 1 μg of total RNA and oligo(dT ...
-
bioRxiv - Immunology 2019Quote: ... cDNA was generating using the GoScript Reverse Transcriptase kit (Promega). Quantitative-PCR was set up using the SensiFAST SYBR Hi-ROX kit (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was then synthesized using AMV reverse transcriptase kit (Promega) with Oligo-dT primer ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized using the M-MLV reverse transcriptase (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Pathology 2021Quote: ... The cDNA was diluted in nuclease-free water (Promega, USA) and used for real-time PCR with either SARS-CoV-2 or GAPDH specific primers ...
-
bioRxiv - Neuroscience 2020Quote: cDNA synthesis was performed with M-MLV reverse transcriptase (Promega) and random hexanucleotides ...
-
bioRxiv - Microbiology 2020Quote: ... and then cDNA was produced using M-MLV RT (Promega) and random hexamers ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated using the GoScriptTM reverse transcriptase kit (Promega) from RNA (250 ng ...
-
bioRxiv - Cancer Biology 2022Quote: ... and cDNA was generated with GoScript Reverse Transcriptase kit (Promega) according to the manufacturers’ instructions ...
-
bioRxiv - Pathology 2022Quote: ... The cDNA was diluted in nuclease-free water (Promega, USA) and used for real-time PCR with either SARS CoV-2 or 18S rRNA specific primers ...