Labshake search
Citations for Promega :
2201 - 2250 of 2354 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were than extracted from agarose gels and purified using the Wizard® SV Gel and PCR Clean-Up System (Promega). Eluted DNA solutions were then precipitated with ethanol and resuspended in RNase-free water.
-
bioRxiv - Developmental Biology 2022Quote: ... The remaining volume in the tube (40 µL) was purified using the Wizard® SV Gel and PCR Clean-Up System (Promega) following the manufacturers’ protocol ...
-
bioRxiv - Genomics 2019Quote: ... We cloned the PCR amplicons into the multiple cloning site of the Firefly luciferase reporter vector pGL4.23 (Promega, Fitchburg, Wisconsin/USA) in both orientations ...
-
bioRxiv - Genomics 2019Quote: ... Genotyping PCR was performed on 50 ng genomic DNA using oligos from Table S3 from for 40 cycles using GoTaq (Promega #M3001) (94°C 2min ...
-
bioRxiv - Cancer Biology 2019Quote: Genomic DNA was isolated and region of sgPten targeting was PCR amplified using GoTaq G2 Green Master Mix (Promega, Cat. # M7823). The PCR product was purified using E.N.Z.A ...
-
bioRxiv - Neuroscience 2019Quote: ... The amplified DNA from each potential off-target site was purified using the Wizard ® SV Gel and PCR Clean-Up System (Promega). The concentration of the purified DNA from the potential off-target sites and the template DNA from the positive control was assessed by using a Nanodrop 2000 Spectrophotometer (Thermo-Fisher) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3ul of gel extracted PCR product was used for TA cloning with the pGEM®-T Easy Vector System (Promega, A1360) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... All PCR reactions were performed at 25µl total with 12.5 ul 2X Promega Hot Start Master Mix (Promega Corporation, Madison, USA) and the primer conditions listed in Tab 1 ...
-
bioRxiv - Immunology 2021Quote: ... Products were isolated from a 2% agarose gel using the Wizard1 SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany). DNA concentration was determined via the Qubit1 1.0 Fluorometer (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... we used a standard curve approach with serial ten-fold dilutions of plasmids engineered to contain single copy PCR templates (pGEM®-T Easy Vector, Promega).
-
bioRxiv - Microbiology 2020Quote: ... were pooled and library cleanup was performed using a Wizard SV Gel and PCR Clean-Up System A9282 (Promega, Madison, WI). The pooled library was submitted to the UW Madison Biotechnology Center (UW-Madison ...
-
bioRxiv - Molecular Biology 2021Quote: ... A DNA fragment spanning the promoter and the 5′ UTR of Eef2 was PCR-amplified from mouse NIH3T3 genomic DNA and substituted for the CMV promoter of the psiCHECK2 vector (Promega, C802A). The intergenic region between Renilla and firefly luciferase in this plasmid was replaced by the sequence of HCV IRES PCR-amplified from psiCHECK2-HCV-IRES (Iwasaki et al. ...
-
bioRxiv - Microbiology 2020Quote: ... The duplicate amplification products of each sample were pooled and purified with the SV Wizard PCR Purification kit (Promega, Madison, WI) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 4 × Promega Wizard® Minicolumns per replicate with a ratio of 0.5:1 virus concentrate to Wizard® PCR Preps DNA Purification Resin (Promega: A7170). The resultant extract was found to be inhibitory to all enzymatic reactions ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was separated on a 1% agarose gel and purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... Candidate clones that showed no trace of a wildtype allele presence were further inspected for separate allelic modifications by cloning of purified aforementioned PCR product into pGEM-T vectors (Promega #A1360) and transformation to NEB 5-a competent E ...
-
bioRxiv - Molecular Biology 2022Quote: ... The vector and digest were both purified using gel extraction using the Wizard® SV Gel and PCR Clean-Up System (Promega) and ligated using T4 ligase (NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... and bands of expected length were excised and purified using the Wizard® SV Gel and PCR clean-up system (Promega). Sequencing PCR was performed using the purified PCR products ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA fragments generated by PCR were cloned into the pGEM-T Easy plasmid vector using the pGEM®-T Easy Vector System (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The 145-160 bp bands (which correspond to inserts of 24-32 nt cDNAs) were extracted and purified using the Wizard® SV Gel and PCR Clean-Up System (Promega). The quality of the library was assessed by the Experion DNA 1K chips (Bio-Rad) ...
-
bioRxiv - Immunology 2022Quote: ... PCR products were run on a 1 % agarose gel and amplicons of the expected size were purified using the Wizard SV Gel and PCR Clean-Up System (Promega, A9282). The samples were submitted to Sanger Sequencing (sequencing service ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial counts were obtained by comparing the signals from the tested samples with a standard curve prepared by serial dilutions of a standard sample purified using the WizardSV Gel and PCR Clean-Up System Kit (Promega, USA) and subsequently cloned into the pGEM-T vector (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... were pooled and library cleanup was performed using a Wizard SV Gel and PCR Clean-Up System A9282 (Promega, Madison, WI). The pooled library was submitted to the UW Madison Biotechnology Center (UW-Madison ...
-
bioRxiv - Microbiology 2021Quote: ... and real-time PCR was performed on 30 ng of DNA with SYBR Green kit GoTaq® qPCR Master Mix (Promega). DNA from non-transduced cell was isolated and amplified at the same time to demonstrate the absence of contamination ...
-
bioRxiv - Molecular Biology 2019Quote: ... after which fragments between 300-350 base pairs (bp) were excised and purified using the Wizard® SV Gel and PCR Clean-Up System (Promega). The size selected library was diluted to 12 pM and sequencing was performed using a 600 cycle (paired-end ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 25 µL polymerase chain reaction (PCR) mixture was the same for both mtDNA genes using 5x Green GoTaq® Flexi buffer (Promega), 0.2 mM dNTPs ...
-
bioRxiv - Genomics 2021Quote: ... 23.5 μl PCR master mix (20 μl Buffer 5X, 2 μl dNTPs 10 μM, 1.5 μl GoTaq; Promega, cat. no. M3001), and 5 μl of Forward universal primer ...
-
bioRxiv - Genomics 2021Quote: ... the resulting cDNA was diluted ten-fold and used as a template in a PCR reaction with GoTaq qPCR Master mix (Promega, USA) and run on a CFX384 Touch instrument (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... All PCR fragments were digested with KpnI and HindIII restriction enzymes and ligated with pGL3-Basic vector (Promega, Madison, WI, USA).
-
bioRxiv - Neuroscience 2021Quote: ... The amplified PCR products were purified on 1.5% agarose gels and cloned into the pGEM-T vector (Promega Corporation, Madison, WI) for sequence analysis ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was diluted 5 folds with distilled water and used in a reaction mix composed of 1x GoTaq qRT-PCR master mix (Promega, USA) and 10 nM primers for RT-qPCR ...
-
bioRxiv - Plant Biology 2020Quote: ... All PCR amplifications were assembled on ice in 25 μl reactions using 5 μl of 5X Green GoTaq buffer (Promega M3001), 0.5-1 μl of each primer (10 μM) ...
-
bioRxiv - Cell Biology 2021Quote: ... YFP-NLS plasmid was digested by BamHI and HindIII and purified by Wizard® SV Gel and PCR Clean-Up System (Promega). Annealed oligonucleotides encoding UPF1’s NES with HindIII and BamHI overhangs at the end (UPF1-NES wt ...
-
bioRxiv - Cell Biology 2021Quote: ... were generated by digesting UPF1-GFP iso2 plasmid with BsrGI and XbaI (both sites located at the very end of GFP) and purifying it by Wizard® SV Gel and PCR Clean-Up System (Promega). Annealed oligonucleotides encoding the NLS of SV40 or NES of snurportin-1 with a stop codon and BsrGI and XbaI overhangs at the end are ligated into the linearised UPF1-GFP iso2 vector (oligonucleotides listed in Table S1) ...
-
bioRxiv - Bioengineering 2022Quote: ... the mCherry coding sequence was PCR amplified from the plasmid pGFP-bait-MCS-NTR-mCherry using GoTaq® DNA Polymerase (Promega) with primers listed in Supplementary Table S3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The promoter and enhancer candidate regions of ROR1 were amplified by PCR using KOD -Plus- Neo (Toyobo, KOD-401) and subcloned into the pGL3 luciferase reporter vector (Promega, E1751) (Figure 6C) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the integration of antibiotic resistance cassettes or reporter genetic constructs in the genome was confirmed by PCR under standard conditions using the GoTaq Green Master Mix (Promega, USA). The strains used and generated herein are shown in Table S1 ...
-
bioRxiv - Microbiology 2022Quote: ... the PCR was performed in a total volume of 25 μl containing 5 X GoTaq® buffer (Promega, Madison, WI, USA), 2.5 mM MgCl2 ...
-
bioRxiv - Physiology 2022Quote: The prepared PCR fragments were inserted into the pGEM-T vector via T/A cloning following the manufacturer’s recommendations (Promega, Fitchburg, USA). Competent Escherichia coli were transfected with the ligation mix and plated on agar plates as described previously [13] ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Microbiology 2022Quote: ... DNA bands at ∼390bp were excised from gel and purified using Wizard™ SV Gel and PCR Cleanup System (Promega A9282) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The DNA gel bands were excised and purified with a Wizard® SV Gel and PCR Clean-Up System (Promega, WI). The final amplicon products were quantified using the Qubit dsDNA HS Assay kit (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The segment sequences of circPLXNA2 and MDM4 3’UTR containing the putative gga-miR-12207-5P binding sequence were amplified by PCR reaction and then subcloned into the XhoI and SalI restriction sites in the pmirGLO dual-luciferase reporter vector (Promega, USA).
-
bioRxiv - Molecular Biology 2022Quote: ... whereafter the resulting DNA fragments were separated by gel electrophoresis and the required 5821 bp band was purified using the Wizard® SV Gel and PCR Clean-Up System (Promega). In this linear form ...
-
bioRxiv - Cell Biology 2023Quote: ... double digested Capn4 PCR product was ligated with double digested pCWX200 or pLexA using the LigaFAst Rapid DNA Ligation System (Promega, M8226). The constructs were transformed into E ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCRs were performed in a final volume of 25 µL with 12.5 µL of GoTaq Green Mastermix (Promega, Madison WI, USA), 9.5 µL of water ...
-
bioRxiv - Immunology 2023Quote: ... 25 ng of c-DNA was used per reaction in each well containing the 2X SYBR green PCR master mix (Promega, USA) along with appropriate primers ...
-
bioRxiv - Cell Biology 2023Quote: ... a 1839 bp region between two KpnI sites was amplified by PCR and subcloned into pGEM-T Easy (Promega, Madison, WI). This subclone was subjected to site-directed mutagenesis using the Q5 site-directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...