Labshake search
Citations for Promega :
1201 - 1250 of 1564 citations for 2x SYBR Green qPCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... 150 µl were removed from each well and the remaining 50 µl were mixed with 50 µl of 2X Passive Lysis Buffer (Promega), and incubated at 40 rpm for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... USA) and 10 μl of GoTaq 1-Step RT-qPCR (Promega, Madison, WI, USA). Thermal cycling was performed at 50°C for 15min for reverse transcription ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were performed with the GoTaq® Probe 1-Step RT-qPCR System (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and the 200 nM GoTaq® Probe 1-Step RT-qPCR System Kit (Promega). This kit uses GoTaq Probe qPCR Master Mix with dUTP (10 uL) ...
-
bioRxiv - Microbiology 2024Quote: ... USA) and 10 μl of GoTaq 1-Step RT-qPCR (Promega, Madison, WI, USA). Thermal cycling was performed at 50°C for 15 min for reverse transcription ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification was performed using GoTaq® G2 master mixes DNA polymerase (Promega) with the following primer pairs ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR reactions were carried out using GoTaq green PCR reaction buffer (Promega). DNA was cycled according to the following protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR reactions were carried out using GoTaq green PCR reaction buffer (Promega). DNA was cycled according to the following protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... and analyzed by analytical RT-PCR using the GoTaq Green kit (Promega) with primers 1171 and 1174 (see Key Resources Table) ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed using GoTaq Green Mastermix (Promega Corp., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Cell death was assessed using the CellTox Green Cytotoxicity Assay (Promega, USA) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... the CellTiter-Glo 3D Assay was multiplexed with CellTox Green Assay (Promega), a fluorescent dye that selectively and quantitatively binds double-stranded DNA ...
-
bioRxiv - Cancer Biology 2023Quote: Cytotoxicity was measured using CellTox green cytotoxicity assay kit (Promega, Madison, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2021Quote: ... Approximately 3000 animals were collected as a pellet and mixed with the same volume of 2x passive lysis buffer (Promega, E194A) on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by cDNA synthesis using GoScript Reverse transcription mix (Promega, USA). SpCas9 expression was detected with primers chCas9_F1 (5’- GAGAGAATGAAGCGGATCGAAGAG - 3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 μl of Trypsin/Lys-C mix (0.5μg/μl, Promega, V5073) was added to each sample and incubated for 3 hrs at RT in the dark ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 μg/mL Mass Spec Trypsin/Lys-C Mix (V5073, Promega) and 1 mM DTT was added to the samples ...
-
bioRxiv - Systems Biology 2022Quote: ... Proteins were digested with mass spec grade Trypsin/LysC mix (Promega) at a 1:50 (w/w ...
-
bioRxiv - Plant Biology 2021Quote: ... Enzymatic digestion of proteins using LysC/Trypsin Mix (Promega, Fitchburg, WI) was then performed according to the technical manual ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg Lys-C/Trypsin mix protease (Promega, Mass spec grade) were added to each sample (10 mM EPPS pH 8.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... in-gel tryptic digestion (250 ng Trypsin-Lys-C mix Promega V5072 in 50 mM ammonium bicarbonate overnight at 37oC) ...
-
bioRxiv - Pathology 2022Quote: ... Reverse transcription PCR was performed using GoScript Super-Mix (Promega, USA), and RT-qPCR was performed using SYBR Green Super-Mix (Bimake ...
-
bioRxiv - Microbiology 2021Quote: ... a dNTP nucleotide mix containing 200 μM of each nucleotide (Promega), 500 nM each of the primers 2-LTR Forward-M (5′- AGCCTGGGAGCTCTCTGGCTAAC-3′ ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with dNTP mix containing 10 mM of each nucleotide (Promega). Combined reaction mixtures were incubated at 50°C for 10 minutes prior to inactivation at 85°C for 10 minutes.
-
bioRxiv - Developmental Biology 2023Quote: ... and digested with trypsin/Lys-C mix (V5071, Promega, Madison, WI). The resulting peptides were cleaned up with Acclaim™ PepMap™ 100 C18 spin columns (SEM SS18V ...
-
bioRxiv - Cell Biology 2023Quote: ... Beads were then proteolyzed with Trypsin/Lys-C Mix (Promega, V5071) at a 25:1 protein ...
-
bioRxiv - Microbiology 2024Quote: ... dNTP nucleotide mix containing 200 M concentrations of each nucleotide (Promega), and 1.25U of GoTaq DNA polymerase (Promega ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time RT-PCR (qRT-PCR) was performed with the GoTaq qPCR Mastermix (Promega) using the CFX-90 real-time PCR System (Bio-Rad).
-
bioRxiv - Immunology 2021Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Microbiology 2021Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Microbiology 2022Quote: ... PCR-amplification of both nosZ genes used the Promega GoTaq qPCR kit (Promega, Madison, WI) and 1 μL of DNA template (25-50 ng genomic DNA ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was quantified by real-time RT-qPCR (GoTaq 1-step qRt-PCR, Promega) using 3.8μL of extracted RNA and 6.2μL of RT-qPCR mix and standard fast cycling parameters ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified by real-time RT-qPCR (GoTaq 1-step qRt-PCR, Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix and standard fast cycling parameters ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was quantified by real-time RT-qPCR (GoTaq 1-step qRt-PCR, Promega) using 3.8 µL of extracted RNA and 6.2 µL of RT-qPCR mix and standard fast cycling parameters ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative real-time RT-PCR (qRT-PCR) was performed with the GoTaq qPCR Mastermix (Promega) using the CFX-90 real-time PCR System (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR-based genotyping (GoTaq Green MasterMix, Promega, and C1000 Touch Cycler, Bio-rad) was used to detect the genes ...
-
bioRxiv - Cell Biology 2021Quote: ... Splicing was analyzed by radiolabeled PCR of resulting cDNA using GoTaq Green (Promega) spiked with α-32P-deoxycytidine triphosphate (dCTP) ...
-
bioRxiv - Cancer Biology 2022Quote: Cytotoxicity was determined using the CellToxTM Green Cytotoxicity Assay (G8742, Promega, Dübendorf, Switzerland), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... pigrum by 16S rRNA gene colony PCR (GoTaq Green, Promega; Madison, WI, USA) using primers 27F and 1492R and Sanger sequencing from primer 27F (Macrogen USA ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µl DNA was then PCR-amplified with GoTaq® Green Mastermix (Promega) and locus-specific primers that anneal either within or outside of the excised genomic DNA ...
-
bioRxiv - Cell Biology 2020Quote: Cell toxicity was measured using the CellTox™ Green Cytotoxicity Assay kit (Promega), and results were normalized to living cell numbers as evaluated with the CellTiter 96® AQueous One Solution Cell Proliferation Assay Kit (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... Splicing was analyzed by radiolabeled PCR of resulting cDNA using GoTaq Green (Promega) supplemented with α-32P-deoxycytidine triphosphate (dCTP) ...
-
bioRxiv - Microbiology 2020Quote: Cell cytotoxicity and viability were assessed using CellTox(tm) green cytotoxicity assay (Promega) and Cell-Titer Glo 2.0 assay (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... cells were incubated with 100 nM Oregon Green substrate for HaloTag (G280A, Promega) or 100 nM TMR substrate for SNAPtag (S9105S ...
-
bioRxiv - Biochemistry 2022Quote: ... and Caspase 9 activity assays were conducted using CellTox Green Cytotoxicity Assay (Promega), CellTiter-Glo 2.0 Cell Viability Assay (Promega) ...
-
bioRxiv - Cell Biology 2024Quote: ... and also further supplemented with CellTox CellTox Green Cytotoxicity Assay reagent (Promega G8741) by adding 1µL of the dye in 10mL of media ...
-
bioRxiv - Microbiology 2024Quote: Algal cellular integrity was estimated using CellTox Green Cytotoxicity Assay (Promega, WI, USA). C ...
-
bioRxiv - Genomics 2023Quote: ... Cell number was also estimated using the CellTox Green Cytotoxicity Assay (Promega, G8743) according to manufacturer’s instructions.