Labshake search
Citations for Promega :
1051 - 1100 of 1464 citations for 2x SYBR Green qPCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... FluoroTect™ Green Lys in vitro Translation Labelling System (Promega) was used for protein labelling in place of 35 S-methionine in the original protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR was conducted using 1x Green GoTaq Flexi Buffer (Promega), 2.5 mM MgCl2 ...
-
Transcriptome analyses reveal tau isoform-driven changes in transposable element and gene expressionbioRxiv - Neuroscience 2021Quote: The CellTox™ Green Cytotoxicity Assay (Promega, cat no. G8742) was used according to the manufacturer’s instructions to assess cytotoxicity as the result of LV-tau infection and Aβ treatment ...
-
bioRxiv - Developmental Biology 2020Quote: ... Amplifications were performed in 1x Green GoTaq Reaction Buffer (Promega) with 5 µl of 1:3 diluted template DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... with (1:2,000 final volume) or without CellTox Green (Promega) depending on the experiment ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were resuspended in media with CellTox™ Green (Promega) in 96-well plates (100 000 cells/well) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were labeled with 1µM HaloTag Oregon Green Ligand (Promega) according to the manufacturer’s instructions and both the HALO- and eGFP-tagged cell lines were sorted again to enrich for cells expressing the HALO- or eGFP-tagged SHARP rescue constructs (Fig ...
-
bioRxiv - Microbiology 2023Quote: ... All diagnostic PCR analyses were performed using GoTaq Green (Promega) under the following conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... cell death staining was done with the CellTox green (Promega) at a dilution of 0.25ul CellTox/500ul media for 20 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... iMC-linker was labelled using HaloTag Oregon Green Ligand (Promega). Labelled cells expressing the linker were selected and sorted FACS Aria flow cytometer (BD Bioscience).
-
bioRxiv - Cancer Biology 2024Quote: ... Cytotoxicity quantification was performed using the CellTox Green assay (Promega) and a fluorescence plate reader ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 µL of 5× Green GoTaq® Reaction Buffer (Promega), 1 µL of dNTP Mix (10 mM each of dTTP ...
-
bioRxiv - Microbiology 2024Quote: ... PCR were carried out with Green Taq DNA polymerase (Promega) on cDNA using primers described in Table S4 ...
-
bioRxiv - Immunology 2021Quote: ... 10mM dnTP mix and AMV reverse transcriptase (all Promega) was added ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM dNTP mix and RNasin Ribonuclease Inhibitors (Promega). This mixture was incubated at 25 °C for 10 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 11 μL of substrate mix (10 μL of Promega Nano-Glo® Luciferase Assay Buffer ...
-
bioRxiv - Microbiology 2019Quote: ... 0.2 mM of each dNTP (PCR Nucleotide Mix, Promega), 0.1 μM of each primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were digested overnight with LysC/Trypsin mix (Promega) and sequencing-grade modified Trypsin (Promega ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 μl solubilization Solution/Stop Mix (Promega cat. #G4101) was added to each well ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 μL T7 Express Enzyme Mix (Promega, P1320) and incubated at 37 °C for 4 hours unless otherwise indicated ...
-
bioRxiv - Genetics 2022Quote: ... The transfection mix was prepared using Fugene 6 (Promega) at 3µl/ug DNA in 500µl (total volume ...
-
bioRxiv - Genetics 2022Quote: ... 0.5 µg of Trypsin/Lys-C Mix (Promega, U.S.A.) was added ...
-
bioRxiv - Cancer Biology 2019Quote: ... Gel bands were digested using trypsin/LysC Mix (Promega) overnight and samples were cleaned up using Reversed-Phase ZipTip (Millipore ...
-
bioRxiv - Immunology 2019Quote: ... Supernatants were harvested and substrate mix (Promega UK Ltd) was added prior to a 30-minute incubation in the dark ...
-
bioRxiv - Cell Biology 2021Quote: ... 14 μM amino acid mix w/o methionine (Promega)) ...
-
bioRxiv - Biochemistry 2022Quote: ... MS-grade trypsin/Lys-C mix (200 ng, Promega) in 25 mM Tris-HCl (pH 8.0 ...
-
bioRxiv - Biophysics 2022Quote: ... Two PCR reactions using GoTaq G2 PCR mix (Promega) and a pUC19 template were set up ...
-
bioRxiv - Cell Biology 2023Quote: ... After overnight digestion with Trypsin/Lys-C mix (Promega), peptides were transferred ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Trypsin/Lys-C Mix (Promega, Madison, WI, USA) at a 1:50 ratio in a ThermoMixer C (Eppendorf ...
-
bioRxiv - Neuroscience 2022Quote: ... a mixture of plasmid DNA and calcium chloride (50 μl, 2.5 M) was added dropwise to 50 μl 2x HEPES buffered saline (E1200, Promega) and incubated for 20 minutes at room temperature in the dark ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 50 μL of cell lysate from each sample to 50 μL of the GSH-Glo™ Reagent 2X (Promega) with DTT (~2.5 mM final ...
-
bioRxiv - Cancer Biology 2023Quote: Neutrophils were incubated in triplicate at 100,000 per well in PCa CM with 2x Real-Time Glo reagent (Promega). MT Cell Viability Substrate and NanoLuc® Enzyme were added in equal volumes to culture media to create the 2x Real-time Glo reagent ...
-
bioRxiv - Cancer Biology 2021Quote: ... and real-time PCR using GoTaq 2-Step RT-qPCR kit (Promega, A6110). All measurements were normalized against Actin as the internal control using the 2-ΔΔCt method (Figure 1—source data 3 and Figure 3—source data 2) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2023Quote: ... GoTaq® Probe 1-Step RT-qPCR System was purchased from Promega (US). SARS-CoV-2 (2019nCoV ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was prepared by reverse transcription (GoTaq 2-Step RT-qPCR System, Promega) and amplified byPCR using SYBR® Green PCR Master Mix and ABI Prism7900HT sequence detection system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time PCR was performed using Gotaq® qPCR mastermix (Promega, Madison, WI) and a CFX 96 real-time system (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was prepared by reverse transcription (GoTaq 2-Step RT-qPCR System, Promega) and amplified by PCR using SYBR® Green PCR Master Mix and ABI Prism 7900HT sequence detection system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then treated with compounds and CellTox Green Dye (Promega) to monitor compound cytotoxicity ...
-
bioRxiv - Cell Biology 2019Quote: ... Cell death was assessed by CellTox™ Green Cytotoxicity Assay (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Cytotoxicity was measured with CellTox™ Green Cytotoxicity Assay (Promega, #G8742), according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... the imaging medium was supplemented with CellTox Green (50’000 × dilution, Promega), 1 µM DRAQ7 and/or 1 µg/ PacificBlue-conjugated Annexin V (BioLegend) ...
-
bioRxiv - Microbiology 2021Quote: ... the LOs were stained using Cell Toxicity Green reagent (CTxG, Promega), and cell nuclei were stained with DAPI ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μL of the CellTox Green Reagent (1:500, G8741, Promega) were added to bacteria ...
-
bioRxiv - Cell Biology 2022Quote: ... 5.0 μl of 5X Green Go Taq ® Flexi buffer (PROMEGA), 3.0 μl MgCl2 (25mM ...
-
bioRxiv - Developmental Biology 2020Quote: ... Genomic DNA for PCR genotyping with GoTaq® Green Mastermix (Promega) and Sanger sequencing was then extracted using QuickExtract™ DNA Extraction Solution (Lucigen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was PCR amplified with Promega GoTag green mastermix (Promega #M7123). PCR amplicon sizes for CRKL ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was PCR amplified with Promega GoTag green mastermix (Promega #M7123). Surveyor was performed using IDT Surveyor kit (IDT #706020 ...
-
bioRxiv - Neuroscience 2020Quote: ... The PCR reaction was performed with the GoTaq Green Mastermix (Promega) in a total volume of 50 µl in the presence of 0.2 µM of each oligo ...
-
bioRxiv - Immunology 2020Quote: ... 10ng of cDNA was used per reaction with Syber Green (Promega). All the primers (described in Table 1 ...