Labshake search
Citations for Promega :
1101 - 1150 of 1464 citations for 2x SYBR Green qPCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... cell pools were stained with Oregon Green® HaloTag (Promega, G2801) ligand and single clones isolated using fluorescence-activated cell sorting (FACS ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was performed using GoTaq® Green (Promega, Madison, WI, USA), according to the manufacturer’s protocol for RT ...
-
bioRxiv - Microbiology 2023Quote: ... and 2.5 U GoTaq DNA polymerase (GoTaq Green Flexi Kit, Promega) was added to 10 μL genomic DNA template mixture yielding 50 μL total reaction volume ...
-
bioRxiv - Cancer Biology 2023Quote: ... and apoptosis assays were conducted using CellTox Green Cytotoxicity Assay (Promega), CellTiter-Glo 2.0 Cell Viability Assay (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Ift122 cDNAs were amplified using GoTaq Green (Promega, Madison, WI, USA) and the primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were incubated with 0.5x CellTox Green cytotoxicity dye (Promega, G8741), cisplatin (obtained from the Clinical Pharmacy Services ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative real-time PCR was performed using the SYBR premix kit (Promega), and the primer sequences used are listed in Supplemental Table S2 ...
-
bioRxiv - Microbiology 2022Quote: ... were measured in 10 μL of each supernatant mixed with 10 μL 2X Renilla lysis buffer (RLB) by Renilla Luciferase Assay Kit (Promega) in white 96 well plates on a Berthold plate reader ...
-
bioRxiv - Cancer Biology 2023Quote: ... where 20 μl of yeast culture was mixed in each well with an equal volume of 2x Passive Lysis Buffer (Promega) to permeabilize cells by 15 minutes of shaking at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was performed for the splicing analysis with the 3 µl of cDNA in a total volume of 20 µl with GoTaq Polymerase 2X (Promega) and 32 amplification cycles ...
-
bioRxiv - Plant Biology 2024Quote: ... 150 µl were removed from each well and the remaining 50 µl were mixed with 50 µl of 2X Passive Lysis Buffer (Promega), and incubated at 40 rpm for 30 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... β-galactosidase activity was measured by absorbance at 420 nm in the Tecan Genios plate reader using 30 uL of each extract mixed with 30 uL of 2x Assay Buffer (Promega).
-
bioRxiv - Molecular Biology 2020Quote: ... 500-ng of Trypsin/Lys-C Mix (Promega Cat#V5072) was added and allowed to digest overnight for ∼18-hr at 37°C ...
-
bioRxiv - Physiology 2019Quote: ... and a mix of oligo dT and random primers (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μl dNTP Mix (10 mM; Promega, Leiden, the Netherlands), 1 U of Phusion Green High-Fidelity DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... The proteins were enzymatically digested using LysC/Trypsin Mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... using a one-step PCR mix (Promega, catalog no. A6120). Zika virus was detected using primer pair ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 50 μL of Luciferin reagent mix (Promega, Luciferase Assay Reagent) were then added to each well ...
-
bioRxiv - Microbiology 2019Quote: ... A 1:25 enzyme:protein ratio of LysC/trypsin mix (Promega) was added to each column in 30 μl of 50 mM HEPES pH 8 with 0.1% sodium deoxycholate (SDC) ...
-
bioRxiv - Biochemistry 2022Quote: ... the proteins were digested by Trypsin/Lys-C Mix (Promega). After the digestion ...
-
bioRxiv - Neuroscience 2023Quote: ... In-gel digestion with Trypsin/Lys-C Mix solution (Promega) was performed as previously described (Gonzalez-Lozano & Koopmans ...
-
bioRxiv - Microbiology 2022Quote: ... GoTaq reaction mix was prepared with 6.5 μL GoTaq (Promega), 1.0 μM primers ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing-grade porcine trypsin/Lys-C mix (Promega, Madison, WI) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then sequencing-grade endopeptidase Trypsin/Lys-C Mix (Promega) was added at an enzyme–substrate ratio of 1:50 wt/wt ...
-
bioRxiv - Cell Biology 2023Quote: ... a mix was prepared consisting of 5 % PEG-8000 (Promega), 100 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Physiology 2023Quote: ... and digested (0.4 ug of Lys-C/Trypsin mix, Promega). After 4 hours of digestion in the urea buffer ...
-
bioRxiv - Immunology 2023Quote: ... followed by cDNA synthesis using GoScript Reverse transcription mix (Promega). The detection of RIG-I ...
-
bioRxiv - Immunology 2024Quote: ... A mix containing 1 µL of 10 mM dNTP (Promega), 5 µL of 0.25 µM NexteraXT primer index ...
-
bioRxiv - Plant Biology 2024Quote: ... the mix containing T7 RNA Polymerase (Promega, Cat No: P2075), Digoxigenin-11-UTP (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... USA) and 10 μl of GoTaq 1-Step RT-qPCR (Promega, Madison, WI, USA). Thermal cycling was performed at 50°C for 15min for reverse transcription ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were performed with the GoTaq® Probe 1-Step RT-qPCR System (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and the 200 nM GoTaq® Probe 1-Step RT-qPCR System Kit (Promega). This kit uses GoTaq Probe qPCR Master Mix with dUTP (10 uL) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification was performed using GoTaq® G2 master mixes DNA polymerase (Promega) with the following primer pairs ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR reactions were carried out using GoTaq green PCR reaction buffer (Promega). DNA was cycled according to the following protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR reactions were carried out using GoTaq green PCR reaction buffer (Promega). DNA was cycled according to the following protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... and analyzed by analytical RT-PCR using the GoTaq Green kit (Promega) with primers 1171 and 1174 (see Key Resources Table) ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed using GoTaq Green Mastermix (Promega Corp., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Cell death was assessed using the CellTox Green Cytotoxicity Assay (Promega, USA) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... the CellTiter-Glo 3D Assay was multiplexed with CellTox Green Assay (Promega), a fluorescent dye that selectively and quantitatively binds double-stranded DNA ...
-
bioRxiv - Cancer Biology 2023Quote: Cytotoxicity was measured using CellTox green cytotoxicity assay kit (Promega, Madison, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell death was assessed using CellTox Green Cytotoxicity Assay reagent (Promega G8741) at 1x final dilution in 12 mL of media and added to cells prior to imaging ...
-
bioRxiv - Physiology 2021Quote: ... Approximately 3000 animals were collected as a pellet and mixed with the same volume of 2x passive lysis buffer (Promega, E194A) on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by cDNA synthesis using GoScript Reverse transcription mix (Promega, USA). SpCas9 expression was detected with primers chCas9_F1 (5’- GAGAGAATGAAGCGGATCGAAGAG - 3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 μl of Trypsin/Lys-C mix (0.5μg/μl, Promega, V5073) was added to each sample and incubated for 3 hrs at RT in the dark ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 μg/mL Mass Spec Trypsin/Lys-C Mix (V5073, Promega) and 1 mM DTT was added to the samples ...
-
bioRxiv - Systems Biology 2022Quote: ... Proteins were digested with mass spec grade Trypsin/LysC mix (Promega) at a 1:50 (w/w ...
-
bioRxiv - Plant Biology 2021Quote: ... Enzymatic digestion of proteins using LysC/Trypsin Mix (Promega, Fitchburg, WI) was then performed according to the technical manual ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg Lys-C/Trypsin mix protease (Promega, Mass spec grade) were added to each sample (10 mM EPPS pH 8.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... in-gel tryptic digestion (250 ng Trypsin-Lys-C mix Promega V5072 in 50 mM ammonium bicarbonate overnight at 37oC) ...
-
bioRxiv - Pathology 2022Quote: ... Reverse transcription PCR was performed using GoScript Super-Mix (Promega, USA), and RT-qPCR was performed using SYBR Green Super-Mix (Bimake ...