Labshake search
Citations for Promega :
901 - 950 of 1464 citations for 2x SYBR Green qPCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... GoTaq 1-Step RT-qPCR kit (Promega) was used at a final volume of 20 μl with ...
-
bioRxiv - Plant Biology 2021Quote: ... A One-step RT-qPCR kit (Promega) was used for converting the RNA into cDNA before amplifying target transcripts on a CFX Connect Real-Time PCR Detection System (Biorad) ...
-
bioRxiv - Pathology 2020Quote: ... using GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 10 μL of 2X furimazine (diluted from Promega 50X stock into CETSA buffer) solution was added to the 10 μL of transfected HEK293T cells in each well ...
-
bioRxiv - Cancer Biology 2020Quote: ... CellTox Green Cytotoxicity Assay (Promega, G8741) was performed according to manufacturer instructions to measure cell death after 72 hours or 48 hours of treatment ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... with Green 1X Go Taq (Promega) buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... containing: Green 1X Go Taq (Promega) buffer ...
-
bioRxiv - Immunology 2023Quote: ... performed with GoTaq Green (Promega; #M7122).
-
bioRxiv - Microbiology 2021Quote: ... A series of concentrations from 50-600nM in symmetric and asymmetric forward and reverse primer concentrations were added to the RT-qPCR reaction using the GoTaq 1-Step RT-qPCR System (Promega) according to the manufacturer’s instructions using the standard annealing temperature of 60°C ...
-
bioRxiv - Microbiology 2020Quote: RT-qPCR analyses of NoV GII were carried out using GoTaq® Probe 1-Step RT-qPCR System (Promega, USA). Primers and the FAM/TAMRA-labelled probe of NoV GII were according to ISO 15216-1:2017 ...
-
bioRxiv - Microbiology 2022Quote: Plasmids used as standard to normalize the qPCR data were obtained by blunt end ligation of the flavivirus qPCR products into pGEM-3Z (Promega), using SmaI (NEB ...
-
bioRxiv - Microbiology 2022Quote: RT-qPCR analyses of NoV GII were carried out using GoTaq® Probe 1-Step RT-qPCR System (Promega, USA). Primers and the FAM/TAMRA-labelled probe of hNoV GII were according to ISO 15216-1:2017 ...
-
bioRxiv - Immunology 2021Quote: ... 4μg trypsin/LysC mix (Promega) were then added and incubated for 4 h @37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 mM rNTP mix (Promega) and 0.1 μg/μL of plasmid DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... 10μM of DNTP mix (Promega), and 18 μL of InVitrogen Ultrapure Distilled Water ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR Nucleotide Mix (Promega, UK) and GoTaq® Flexi DNA Polymerase (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR nucleotide mix (Promega: U144B) and oligo (dT ...
-
bioRxiv - Biophysics 2022Quote: ... and protease inhibitor mix (Promega). Resuspended cells were homogenized in a dounce homogenizer and lysed by addition of 1% Triton X-100 and 5 μl of Benzonase Nuclease (Millipore ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 dNTP mix (Promega, C114B), 0.5 µl Recombinant RNasin® Ribonuclease Inhibitor (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 dNTP mix (Promega, C114B), 0.5 µl Recombinant RNasin® Ribonuclease Inhibitor (Promega ...
-
bioRxiv - Genetics 2024Quote: ... dNTP mix (0.3mM each) (Promega)) with 10 cycles of PCR ...
-
bioRxiv - Genetics 2023Quote: ... GoTaq Master Mixes (Promega, Wisconsin, United States) were used according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Either GoTaq 1-Step RT-qPCR System (Promega) was used or reverse transcription for mRNAs was performed using Superscript IV RT (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... using the GoTaq qPCR Mastermix (Promega, Walldorf, Germany) and cDNAs synthesized from DNase- treated total RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... or the GoTaq® qPCR kit (Promega, A6001) was used ...
-
bioRxiv - Physiology 2020Quote: ... GoTaq® qPCR MasterMix (Promega, Madison, WI, USA) and 3ng of DNA sample were combined to amplify both mtDNA and nuclear DNA by 7900HT RT-PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using GoTaq DNA polymerase (Promega), EvaGreen (Biotium ...
-
bioRxiv - Biochemistry 2023Quote: ... and GoTaq 1-Step RT-qPCR System (Promega) were used for qPCR assays ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Microbiology 2022Quote: ... RNA samples and the negative extraction controls were screened in duplicate to investigate the presence of YFV RNA by RT-qPCR (GoTaq Probe 1-Step RT-qPCR System-Promega, USA), with primers and probes targeting the 5’-noncoding regions of the YFV genome (39) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Levels of reporter mRNAs in eggs were measured 6 hrs post-injection by RT-qPCR using the GoTaq 2-Step RT-qPCR system as per manufacturer’s instructions (Promega, Madison, WI) with random primers for reverse transcription and oligos listed in Table 1 for the qPCR step.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 2x HEPES-buffered saline (HBS) (59)] or Fugene6 transfection methods (Promega, Madison, WI). Transiently transfected cells were always assayed or imaged at 48 hours post-transfection.
-
bioRxiv - Microbiology 2023Quote: The quantification of viral RNA was carried out in one-step RT-qPCR using 3 µl of the eluted RNA with the GoTaq® Probe One-step RT-qPCR System (Promega, Poland). This procedure employed in-house primers and a probe specifically tailored for the HCoV-229E N sequence ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5X Green GoTaq® Reaction Buffer (Promega), 25mM MgCl2 ...
-
bioRxiv - Genetics 2019Quote: ... Go-Taq green flexi buffer (#M8911, Promega) was added to all samples after amplification ...
-
bioRxiv - Bioengineering 2020Quote: ... as well as with CellTox Green (Promega). Drug treatment began on day 1 and was performed in duplicate (10-point ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed using GoTaq Green (Promega) according to the vendor protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed using GoTaq Green (Promega) according to the vendor protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5X Green GoTaq® Reaction Buffer (Promega), 2.5mM of each dNTP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5X Green GoTaq® Reaction Buffer (Promega), 25mM MgCl2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CellTox Green Cytotoxicity Assay (Promega, cat # G8741) was used to quantify cytotoxicity according to manufacturer protocol ...
-
bioRxiv - Microbiology 2023Quote: ... CellTox Green Cytotoxicity Assay Kit (Promega, USA); and SYBR Green PCR Master Mix Kit (Baosheng Bioscience (Dalian ...
-
bioRxiv - Cell Biology 2020Quote: ... using the the GoTAQ qPCR Mastermix (Promega, cat #A6001) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Real Time qPCR was performed using GoTaq polymerase (Promega) and the StepOnePlus real-time PCR thermocycler (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... the GoTaq® 1-Step RT-qPCR System (Promega) was used with the primers (F ...
-
bioRxiv - Biochemistry 2021Quote: ... and GoTaq® 1-Step RT-qPCR System (Promega) were used for RT-qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... or by qPCR (ProNex NGS Library Quant Kit, Promega). DNA libraries were sequenced on Illumina NextSeq 500 or Illumina MiSeq platforms.
-
bioRxiv - Molecular Biology 2021Quote: ... 0.23 mM (each) dNTP mix (Promega), 0.35 Units E ...
-
bioRxiv - Biochemistry 2021Quote: ... amino acid mix lacking Met (Promega) and 0.1 × volume of an in vitro transcribed mRNA (200-1,000 ng/μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.125 µl dNTPs mix (Promega #U1515), 0.25 µl 5X Q5 Polymerase Buffer (NEB #M0491) ...