Labshake search
Citations for Roche :
1851 - 1900 of 7357 citations for Human Dual Specificity Phosphatase 3 DUSP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... cells were lysed with an ice-cold Lysis/Wash Buffer supplemented with fresh protease and phosphatase inhibitors (Roche). Cell lysates were pre-cleared by incubating the lysate with Control Agarose Resin at 4°C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: Protein lysates were prepared from snap-frozen dorsal skin with urea buffer (8 M Urea, 40 mM Tris-HCl, 2.5 mM EDTA, pH 8.0) containing phosphatase (PhosSTOP, Roche) and protease inhibitors (cOmplete Protease Inhibitor Cocktail Tablet EDTA-free ...
-
bioRxiv - Physiology 2019Quote: ... 0.1% SDS and 0.5% sodium deoxycholate with PhosStop Phosphatase-Inhibitor Cocktail tablet and protease-inhibitor cocktail tablet (Roche). The homogenate was centrifuged at 4°C for 10 min at 14,000g and the supernatant was used for western blot analysis ...
-
bioRxiv - Cell Biology 2019Quote: ... and the other one was treated with Lambda PP in the presence of phosphatase inhibitor cocktail (Roche, #04906837001). After incubated at 30°C for 30mins ...
-
bioRxiv - Pathology 2019Quote: ... supplemented with protease and phosphatase inhibitors (Complete Mini protease inhibitor tablet and Phos-stop inhibitor tablets; Roche, UK) and processed for immunoblotting using standard methods see supplementary methods
-
bioRxiv - Genetics 2020Quote: ... 200 μl lysis buffer (8M Urea, 1% SDS, 50 mM Tris pH 8.5, Roche protease and phosphatase inhibitor) were added to the pellet and samples were vortexed and sonicated on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were washed with 10ml of cold 1x PBS supplemented with proteinase inhibitors and phosphatase inhibitors (Roche # 4693132001) and the pellets were snap frozen in liquid nitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were lysed with RIPA buffer containing a complete protease and phosphatase inhibitor tablet (Roche #11836153001, #PHOSS-RO). Lysates were cleared by centrifugation at 14,000xq for 15 min at 5°_C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-DIG antibody conjugated to alkaline phosphatase allowed detection of hybridized riboprobes according to the manufacturer’s instructions (Roche).
-
bioRxiv - Developmental Biology 2022Quote: ... DIG was detected with anti-DIG Fab fragments conjugated to alkaline phosphatase (Roche, Indianapolis IN; 1:2000 dilution). Alkaline phosphatase activity was revealed using NBT/BCIP (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50mM TRIS-HCl pH 7.4) supplemented with protease and PhosSTOP phosphatase inhibitor (ref. 04 906 845 001 – Roche). Antibodies were diluted at 1:1000 in PBS - 0.1% Tween - 5% non-fat dried milk.
-
bioRxiv - Developmental Biology 2022Quote: ... The bound ribopropbe was detected using an alkaline phosphatase-conjugated goat anti-DIG Fab fragment (1:750; Cat#: 11093274910, RRID:AB_514497; Roche) and the HNPP/FastRed detection kit (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM DTT) supplemented with cOmplete Mini EDTA-free protease inhibitor cocktail and PhoshoStop phosphatase inhibitor tabs (Roche) at 4 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 % blocking reagent before incubation in a blocking solution with anti-DIG alkaline phosphatase (AP) conjugated antibody (Roche) diluted 1 ...
-
bioRxiv - Plant Biology 2022Quote: ... Hybridized probes were detected by anti-DIG antibodies conjugated with alkaline phosphatase enzyme (anti-DIG-AP) (Roche, Germany). Photographs were captured using an Olympus BX51 compound microscope using a DP74 Olympus camera.
-
bioRxiv - Neuroscience 2023Quote: ... 1% Triton-X100 and 1x protease and 1x phosphatase inhibitors cocktails (Complete Mini EDTA-free and phosSTOP, Roche). Lysates were cleared of debris by centrifugation (14,000 rpm ...
-
bioRxiv - Developmental Biology 2023Quote: ... Riboprobes produced as described above were detected using alkaline-phosphatase-conjugated anti-digoxigenin Fab fragments (1:2000, [Roche]). Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP ...
-
bioRxiv - Neuroscience 2023Quote: Tissues were diluted in RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 1% Triton-X100, freshly added protease/phosphatase inhibitors [Roche]), and homogenised using stainless steel beads and a QIAGEN TissueLyser II (shaking 1 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1% Triton X-100) supplemented with 1X complete protease inhibitor cocktail and 1X complete phosphatase inhibitor cocktail (Roche) using a Precellys Evolution homogenizer (Bertin Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing protease and phosphatase inhibitor cocktails (cOmplete™, Mini Protease Inhibitor Cocktail, Sigma #11836153001; PhosSTOP™, Roche #4906845001). Protein quantification was determined using the BCA protein assay (Pierce™ BCA Protein Assay Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Plant Biology 2024Quote: ... Immunodetection was performed using an anti-DIG antibody coupled to alkaline phosphatase (Anti-Digoxygenin-AP, Fab fragments, Roche), whose activity was detected by the chromogenic method using NBT/BCIP (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pellets were resuspended in 500 µL cold cell lysis buffer (5 mM PIPES pH8.0, 85 mM KCl, 0.5% NP-40, 1x protease/phosphatase inhibitor, Roche) and lysed (10 min on ice) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1.5 mM MgCl2, 1 mM EDTA, 1 mM DTT, 0.075% NP-40, 1x protease/phosphatase inhibitor cocktails, Roche) and incubated for 10 minutes at 4°C with rotation ...
-
bioRxiv - Molecular Biology 2024Quote: ... 400 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1 mM DTT, 5% glycerol, 1x protease/phosphatase inhibitor cocktails, Roche). Nuclear lysates were diluted with 2 volumes of dilution buffer (20 mM HEPES pH7.9 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pellets were resuspended in 300 µL cold cell lysis buffer (5 mM PIPES pH8.0, 85 mM KCl, 0.5% NP-40, 100U Ribolock inhibitor, Thermo, 1x protease/phosphatase inhibitor, Roche) and lysed (10 min on ice) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were lysed in lysis buffer (50mM Tris pH 7.5, 150mM NaCl, 1mM EDTA, 5mM MgCl2, 0.5% NP40, Protease and Phosphatase inhibitors (Roche), Pierce Universal Nuclease (Thermo) ...
-
Treatment with furosemide indirectly increases inhibitory transmission in the developing hippocampusbioRxiv - Neuroscience 2023Quote: ... 1% Triton-X100 and 1x protease and 1x phosphatase inhibitors cocktails (Complete Mini EDTA-free and phosSTOP, Roche). Lysates were cleared of debris by centrifugation (14,000 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... In situ hybridization (ISH) signals were visualized using anti-DIG antibody conjugated with an alkaline phosphatase fragment (Roche) and nitro-blue tetrazolium and 5-bromo-4-chloro-3’-indolyphosphate substrates ...
-
bioRxiv - Developmental Biology 2022Quote: ... The incorporation of BrdU was then measured by ELISA at 24h per the manufacturer’s protocol (Roche Diagnostics, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Immunology 2019Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The A20 cells were grown in RPMI-1640 (Gibco ...