Labshake search
Citations for Roche :
1751 - 1800 of 7357 citations for Human Dual Specificity Phosphatase 3 DUSP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... and the residual Placental alkaline phosphatase activity was visualized by incubating the embryos with NBT/BCIP (Roche) in the same buffer at 4°C for 24 h ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with phosphatase and protease inhibitors (cOmplete™ Protease Inhibitor Cocktail and PhosSTOP™; Roche, Rotkreuz, Switzerland). Cells were lysed for 2 h on ice ...
-
bioRxiv - Developmental Biology 2020Quote: ... Tissue sections were incubated in alkaline phosphatase-conjugated anti-DIG antibody (1:1500, Roche Applied Sciences 11093274910) for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP ...
-
bioRxiv - Developmental Biology 2021Quote: ... DIG was detected with anti-DIG Fab fragments conjugated to alkaline phosphatase (Roche, Indianapolis IN; 1:2000), and the chromogenic reaction performed using BM purple (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... Sample lysis was performed in radioimmunoprecipitation (RIPA) buffer complemented with protease inhibitor and phosphatase inhibitor cocktails (Roche) (50 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2020Quote: ... Both lysis buffers were supplemented with phosphatase and Complete™ EDTA-free protease cocktail inhibitor tablet (Roche). Protein concentrations of the lysates was determined using the Bradford assay and all samples were equalised for protein concentration.
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.6) supplemented with protease inhibitor cocktail (cOmplete) and phosphatase inhibitor cocktail (PhosSTOP, both Roche, Basel, Switzerland) using FastPrep-24 5G bead beating grinder (MP Biomedicals ...
-
bioRxiv - Developmental Biology 2021Quote: ... and then lysed in RIPA buffer (50 mM Tris-HCl pH 7.6, 150 mM NaCl, 0.5% NP40, and 0.25% sodium deoxycholate, supplemented with protease and phosphatase inhibitors; Roche). Proteins were immunoprecipitated by the addition of 3 µl of rabbit anti-FGFR3 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1% Triton X-100 supplemented with protease and phosphatase inhibitor cocktail tablets (Roche Diagnostics, Mannheim, Germany). Liquid N2 was used to devastate cell membranes to collect whole protein lysate ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated with alkaline phosphatase-conjugated anti-DIG antibody (1:1000, Roche Applied Science, cat# 1093274) and chicken anti-GFP antibodies (1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1% sodium dodecyl sulfate) containing 1 mM phenylmethylsulfonyl fluoride (PMSF) and proteinase and phosphatase inhibitor cocktails (Roche). The protein extract was centrifuged at 25,000g for 30 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... cell pellet was resuspended in lysis RIPA buffer supplemented with protease inhibitor cocktail and phosphatase inhibitors (Roche) and incubated in ice for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... except 250 OD600 equivalents were harvested and the lysis buffer additionally contained 1x PhosSTOP phosphatase inhibitor (Roche). Eluates were reduced with 10 mM DTT for 15 min at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1% SDS and 0.01% bromophenol blue) containing PhosSTOP phosphatase and Complete protease inhibitor cocktails (both from Roche). Proteins were separated by SDS-PAGE on a 10% polyacrylamide gel ...
-
bioRxiv - Immunology 2019Quote: ... The isolated NETs lysed by RIPA lysis buffer containing phosphatase inhibitor cocktail and protease inhibitor cocktail (Roche) and the NET lysates were used for immunoblot assay.
-
bioRxiv - Pathology 2019Quote: ... Frozen tissues were homogenized and lyzed in radioimmunoprecipitation assay (RIPA) buffer containing protease and phosphatase inhibitors (Roche) followed by centrifugation ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were lysed on ice with RIPA buffer containing protease and phosphatase inhibitors (Complete and PhosSTOP, Roche). Samples were centrifuged for 3 minutes at 15000xg to remove cell debris and treated with DNAse to degrade genomic DNA ...
-
bioRxiv - Physiology 2019Quote: ... at RT followed by incubation with mouse anti-DIG alkaline phosphatase (AP) antibody (1:2000) (#11093274910, Roche) in Roche blockingbuffer (1:10 in PBT ...
-
bioRxiv - Immunology 2019Quote: ... supplemented with complete EASYpack Mini Protease Inhibitor Cocktail and PhosSTOP Phosphatase Inhibitor (both from Roche Applied Science). Cell lysates were separated by SDS-gel electrophoresis and transferred to PVDF membranes (Merck Millipore) ...
-
bioRxiv - Systems Biology 2021Quote: ... and 0.5 mM Dithiothreitol) supplemented with cOmplete mini EDTA-free protease and PhosSTOP phosphatase inhibitor cocktails (Roche), samples were incubated on a rotator for at least 10 minutes and then adjusted to 6 ml total volume with additional Suspension Buffer supplemented with inhibitors before centrifugation at 18,000 rpm for 10 minutes ...
-
bioRxiv - Cell Biology 2021Quote: Proteins were extracted from tissue by homogenising in RIPA buffer (150mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, 50mM Tris, pH 7.5) containing phosphatase (Roche) and protease (Roche ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and then incubated with buffer B1 containing alkaline phosphatase conjugated anti-DIG antibody (Roche 11093274910, 1:5000) and 1% heat-inactivated normal goat serum at 4°C overnight ...
-
bioRxiv - Systems Biology 2019Quote: ... Proteins from fracture femora were extracted by RIPA buffer combined with protease inhibitors and phosphatase inhibitors (Roche). The supernatants were obtained by centrifugation (12,000g ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were incubated overnight at 4°C with 1:4000 alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche) in buffer 2 ...
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal tissue was hand homogenized in 10x w/v RIPA buffer with protease and phosphatase inhibitors (Roche). Homogenates were centrifuged at 14,000 rpm for 30 minutes at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... and detected using an anti-DIG antibody coupled to alkaline phosphatase (1:5000, Roche, cat no. 11093274910) and NBT/BCIP staining (Roche ...
-
bioRxiv - Immunology 2020Quote: ... cells were washed with PBS and lysed in RIPA buffer with added protease and phosphatase inhibitors (Roche). Samples were sonicated ...
-
bioRxiv - Immunology 2021Quote: ... cells were lysed with RIPA lysis buffer containing complete protease inhibitor cocktail and phosphatase inhibitor cocktail (Roche) for the detection of S protein by western blot or ELISA ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were re-suspended in 150 μl of 1x PBS supplemented with protease and phosphatase inhibitors (Roche), mixed with 50 μl of 4x Laemmli loading buffer and boiled for 5 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... or 1:4000 for anti-dig-alkaline phosphatase used in colorimetric in situ hybridizations (Roche, Basel Switzerland). For multiplex FISH ...
-
bioRxiv - Cancer Biology 2022Quote: ... drug-treated cells were lysed in RIPA buffer supplemented with a phosphatase inhibitor cocktail (Roche, Mannheim, Germany) and 1mM PMSF on ice for 20min ...
-
bioRxiv - Physiology 2022Quote: Livers were lysed in 1X RIPA buffer supplemented with a protease/phosphatase inhibitor cocktail (cOmplete mini ROCHE 1:25 v/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tissue samples were lysed in RIPA buffer supplemented with protease and phosphatase inhibitors (Roche, Cat# 04693159001, 04906837001) using TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2023Quote: ... 0.2% Sodium Dodecyl Sulphate and supplemented with Complete™ Mini protease and phosphatase inhibitors cocktails (Roche, France). Then ...
-
bioRxiv - Physiology 2023Quote: ... SDS 0.1% supplemented with Complete Protease Inhibitor Tablets and PhosSTOPTM phosphatase inhibitor tablets (Roche Diagnostics, Basel, Switzerland). Tissue lysates were centrifuged at 15,000 g and 4°C for 20 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% NP-40) containing protease and phosphatase inhibitors (cOmplete™ and PhosTOP™, Roche/Merck, Dorset, UK), 1 mM sodium orthovanadate and 1 mM phenylmethylsulfonyl fluoride and incubated for 30 min on ice.
-
bioRxiv - Cell Biology 2023Quote: ... Lysis buffer included 142.8ul 7x protease/phosphatase inhibitor stock (mixture of Roche Cat#11836153001 and Cat#4906845001), 100ul 10x RIPA buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... Hybridization signal was visualized with an anti-DIG antibody conjugated to alkaline phosphatase (RRID: AB_514497; Roche Diagnostics) and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were lysed using 10X Cell Lysis Buffer (Cell Signalling) supplemented with protease and phosphatase inhibitors (Roche). Protein concentration was determined using a BCA protein assay kit (Pierce ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were lysed in RIPA buffer supplemented with protease and phosphatase inhibitors (mini cOmplete and phosSTOP, Roche) on ice for 10 min.
-
bioRxiv - Molecular Biology 2023Quote: ... Detection with anti-digoxigenin antibody conjugated with alkaline phosphatase (Anti-Digoxigenin-AP Fab fragments, 11093274910, Roche, Switzerland) and activation with the chemiluminescent substrate CDP-Star (11759051001 ...
-
bioRxiv - Immunology 2023Quote: Cells were lysed with RIPA complete lysis buffer supplemented with EDTA-free protease and phosphatase inhibitors (Roche) and 25 U of Benzonase Nuclease ...
-
bioRxiv - Immunology 2024Quote: ... and 0.5% Triton X-100) with 1x protease and phosphatase inhibitors (c0mplete™ Protease Inhibitor Cocktail, Roche, product number 04693159001 ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were washed and incubated with an anti-DIG antibody coupled to alkaline phosphatase (Roche, 1:3,000). Staining used BM-Purple (Roche).
-
bioRxiv - Molecular Biology 2024Quote: ... 1.1% triton x-100, 1.2 mM EDTA, 16.7 mM tris-HCl pH8.0, 167 mM NaCl, 1x protease/phosphatase inhibitor, Roche). Diluted samples were aliquoted ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear lysates were diluted with 2 volumes of dilution buffer (20 mM HEPES pH7.9, 1.6% triton x-100, 0.2% sodium deoxycholate, 1x protease/phosphatase inhibitor cocktails, Roche), followed by 10 sec sonication with a Bioruptor (Diagenode ...
-
bioRxiv - Cell Biology 2024Quote: Cells were lysed in reducing Laemmli SDS sample buffer containing PhosSTOP (Phosphatase Inhibitor Cocktail Tablets, Roche, Switzerland) at 96°C for 10 min and the proteins separated on NuPAGE® Novex® 4–12% Bis–Tris Gels ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...