Labshake search
Citations for Roche :
1351 - 1400 of 3664 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Reactions of qRT-PCR were set up with 50-70ng of cDNA and 250 nM gene-specific primers using FastStart Universal Sybr Green Master (Rox) mix (Roche). Fold change in transcript levels for deregulated genes was calculated as follows ...
-
bioRxiv - Microbiology 2023Quote: ... the specified primer concentrations and 2X SYBR Green I Master Mix solution (LightCycler® 480 SYBR Green I Master, Roche). Standard curves were generated from known concentrations of 10-fold serial diluted DNA from B ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting NGS adapter ligated cDNA was then amplified with KAPA HiFi HotStart ReadyMix using NGS indexing primers for 25 cycles (ROCHE). Amplified DNA fragments between 150∼500nt were size selected by gel extraction purification following gel-electrophoresis in a 4% SYBR-GOLD E-GEL ...
-
bioRxiv - Genomics 2023Quote: ... Bisulfite converted DNA library was amplified using truncated TruSeq™–Compatible Indexing Primer and KAPA HiFi Uracil+ ReadyMix (Roche, KK2801), supplemented with MgCl2 ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μL of sample were used in a reaction mix containing 1 μL 10 μM of each primer (0.5 μM final) and 5 μL 2x Light Cycler SYBR Green LightCycler® 480 SYBR Green I Master (Roche). For telomere amplification ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR reactions were conducted with 50 ng of genomic DNA and following primer pairs spanning the sgRNA target site in KAPA HiFi HotStart ReadyMix (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Primers and Taqman probes were designed using Probe Finder software in the Universal Probe Library (UPL) Assay Design Center (Roche). All PCR reactions were performed using a StepOne System (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2023Quote: ... qPCR was performed on the pool to confirm the concentration measured with Qubit using the KAPA Library Quantification Standards with Primer (Roche Sequencing Solutions Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting cDNAs were amplified with primers DP3 and DP5 (5’-GTTCAGAGTTCTACAGTCCGACGATC-3’, 0.5 μM) and KAPA Hifi HotStart DNA polymerase (Roche, KK2601) to the optimal amplification point ...
-
bioRxiv - Microbiology 2024Quote: ... Primer pair mix with 7 µL of 2X SYBR green (LightCycler 480 SYBR Green I Master; Roche; Cat No. 04707516001) and 1 µL of 10 µM of forward and reverse primer were prepared for all the gene targets ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 ng of DNA was analyzed by qPCR using primers specific for vector DNA (GFP) and genomic DNA (ADCK3) on a LightCycler 480 II (Roche). Viral genomes per cell were calculated by dividing total viral genomes (detected by GFP ...
-
bioRxiv - Neuroscience 2024Quote: ... and T7 promoter sequence was added on all the reverse primers for generating antisense mRNA probes using T7 RNA polymerase (Roche). For immunohistochemistry (IHC ...
-
bioRxiv - Microbiology 2020Quote: All PCR reactions were performed using a SYBR green real-time PCR protocol (qPCRBIO SyGreen, PCR Biosystems) in a Lightcycler 96™ instrument (Roche). The amplification conditions were ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative Real-time PCR was performed using TaqMan Universal PCR master Mix (applied biosystem, 4304437) or KAPA SYBR FAST (Roche, KK4605). Primers and TaqMan probes are shown in Supplementary Table 16.
-
bioRxiv - Biochemistry 2019Quote: ... The cDNA was then used to perform qRT PCR using the KAPA SYBR FAST qRT PCR master mix kit (KK4602, KAPA Biosystems) as per the manufacturer’s instructions ...
-
Interdependent Iron and Phosphorus Availability Controls Photosynthesis Through Retrograde SignalingbioRxiv - Plant Biology 2021Quote: ... Real-time quantitative reverse-transcription PCR (qRT-PCR) was performed as described in33 using 384-well plates with a LightCycler 480 Real-Time PCR System (Roche diagnostics). The Ubiquitin 10 mRNA (UBQ10 ...
-
bioRxiv - Plant Biology 2020Quote: ... Fifty µl of cDNA were amplified by 13 PCR cycles with the Kapa HiFi PCR kit (Kapa Biosystems, Wilmington, MA, USA) followed by size selection from 1.5kb to 3.5kb with a BluePippin system (Sage Science ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification of HBV RNAs were performed using primers as previously described43 using a SYBR green real-time PCR protocol (qPCRBIO SyGreen, PCR Biosystems) in a Lightcycler 96™ instrument (Roche). The amplification conditions were ...
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... the small fragments from the cDNA amplification are purified and the library is barcoded and amplified using PCR with the KAPA high fidelity PCR kit(KAPA Biosystems). After all libraries are ready their quality and size are measured using the bioanalyzer before being sequenced on a NEXTseq (Illumina).
-
bioRxiv - Molecular Biology 2019Quote: ... Each PCR reaction was composed of the following ingredients: 1 μl 10× FastStart PCR Buffer comprising 20 mM MgCl2 (Roche Diagnostics), 0.2 μl dNTPs (10 mM each) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The expression level of different genes was assessed with quantitative real-time PCR using the LightCycler Real-Time PCR system (Roche Diagnostics) and the primers described in the Supplementary data ...
-
bioRxiv - Microbiology 2021Quote: The full-length hAce2 gene was PCR-amplified from Mammalian Gene Collection cDNA clone (clone number MGC:47598) using a Kapa HiFi PCR kit (Kapa Biosystems) with a primer pair (Forward ...
-
bioRxiv - Microbiology 2021Quote: ... the SARS-CoV-2 Spike gene with a 54-nucleotide deletion at the C-terminus was PCR-amplified from synthetic DNA (provided by Alex Ma, Academia Sinica, Taiwan) using the Kapa HiFi PCR kit (Kapa Biosystems) with a primer pair (Forward ...
-
bioRxiv - Biochemistry 2019Quote: ... V187 were replaced by NNK codons in three rounds of inverse PCR using the Expand™ High Fidelity PCR System (Roche). One PCR reaction contained 1x Buffer 2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 ng of 4C-template DNA was used to PCR amplify the libraries using the Roche Expand long template PCR system (Roche, 11681842001). Primers were removed using SPRIselect beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse transcription product was used to perform quantitative PCR (qPCR) with a real-time PCR detection system (LightCycler®480; Roche). The 10-μl qPCR reaction mixture contained 1 μl cDNA ...
-
bioRxiv - Genomics 2020Quote: ... a total of 1.0 μg of extracted DNA was used as the starting material for PCR-free library construction (KAPA HyperPrep PCR-Free Library Prep kit; Roche, #KK8505); libraries were then mechanically sheared (Covaris microtube system ...
-
bioRxiv - Immunology 2021Quote: ... an Illumina adaptor-extension singleplex PCR step was performed using 820.000 copies of the previous PCR product with 1X KAPA HIFI HotStart ReadyMix (KAPA Biosystems KK2601), followed by double-sided (0.5X–0.8X ...
-
bioRxiv - Cancer Biology 2022Quote: ... We next amplified full-length 1.7kb NT5C2 DNA insert by PCR using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems, #KK2601) and the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... indexes and sequencing sequences) was performed on 5 µl of purified first step PCR products using Expand™ Long Template PCR System (Roche) with the following thermocycling program ...
-
bioRxiv - Genomics 2023Quote: The 19.5 μl eluate was placed in a 0.2 ml PCR tube preloaded with a PCR reaction mixture containing 25 μl of 2x KAPA HiFi HotStart Uracil+ ReadyMix (Roche, KK2801), 1.5 μl of 25 μM P5 transposon primer (ordered from IDT with the sequence shown in Supplementary Fig ...
-
bioRxiv - Plant Biology 2023Quote: ... Expression of mRNA and pre-mRNA was then assayed by semi-quantitative reverse-transcription PCR (qRT-PCR) on a Roche LightCycler480 using SYBR Green I (Roche Diagnostics). Raw fluorescence data were analysed using LinRegPCR to perform background subtraction ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4×200 ng of 4C-template DNA was used to PCR amplify the libraries using the Roche Expand long template PCR system (Roche, 11681842001) with the following PCR conditions ...
-
bioRxiv - Neuroscience 2023Quote: A total of 1.0 µg of extracted DNA was used for PCR-free library construction using the KAPA HyperPrep PCR-Free Library Prep kit (Roche, KK8505). Mechanical shearing using the Covaris microtube system (Covaris ...
-
bioRxiv - Microbiology 2024Quote: ... The mRNA transcript levels of selected IVSPER genes were measured by quantitative reverse transcription-PCR (qRT-PCR) using a LightCycler® 480 System (Roche) and SYBR Green I Master Mix (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... and CDT genes was determined by quantitative reverse transcriptase PCR (qRT-PCR) in a LightCycler 480 thermal cycler (Roche Diagnostics, USA). The primers specific for toxin A ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Cancer Biology 2019Quote: ... qRT-PCR was performed using LightCycler 480 SYBR Green I Master Mix on a LightCycler 480 Real-Time PCR System (Roche, Mannheim, Germany). Relative expression was calculated based on the 2−ΔΔCt method and GAPDH was used as the internal control ...
-
bioRxiv - Physiology 2021Quote: ... a 6.7 kb DNA fragment starting 1 kb upstream of murine Gnrhr exon 3 was amplified by PCR using the Expand Long Template PCR System (Roche, Basel, Switzerland) from 129SvEv genomic DNA using primers incorporating 5’ XmaI and 3’ NotI restriction enzyme sites (Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification of 16S rRNA genes was conducted using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA, USA) in a total volume of 25 μl containing inner primer pairs (50 nM each ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification of the 16S rRNA gene was performed using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, MA, USA) with an inner primer pair (50 nM for each ...
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... A master mix was made for each qRT-PCR target containing 5 ul of KAPA Universal SYBR Fast PCR mix (KAPA Biosystems, #KK4602), 0.6ul of 5 uM forward primer ...
-
bioRxiv - Microbiology 2022Quote: ... The agtA gene disruption cassette was generated by fusion PCR using an Expand High Fidelity PCR System (F. Hoffmann-La Roche, Basel, Switzerland). The 5′- and 3′-arms of agtA were amplified from wild-type A ...
-
bioRxiv - Microbiology 2019Quote: ... The V3-V4 region of the 16S rRNA gene was PCR amplified using the KAPA HotStart PCR Kit (Kapa Biosystems, Wilmington, MA) with 10 µL Kappa HotStart Mastermix ...
-
bioRxiv - Synthetic Biology 2020Quote: ... taiwanensis VLB120 was used as the template for the PCR and was isolated using the High Pure PCR Template Preparation Kit (Hoffmann-La-Roche, Basel, Switzerland). Plasmids were constructed by Gibson assembly using the NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Immunology 2021Quote: ... 5 μl of the resulting cDNA-containing reverse transcription mixes were then used as templates for 25 μL PCR reactions using the KAPA HiFi PCR kit with GC buffer (Roche Diagnostics, #07958846001) and the following thermal cycling conditions ...
-
bioRxiv - Immunology 2020Quote: ... and 0.1 μl to 0.2 μl of cDNA generated were analyzed by SYBR Green-based real time PCR (real time-PCR) (Roche Diagnostics, Laval, QC) using 300 nM of gene-specific primers ...
-
bioRxiv - Genetics 2022Quote: ... Quantitative PCR was performed in 4 replicates in final volume of 10 µL using Light SYBR Green PCR Master Mix (Roche, Applied Science) on a LightCycler 480 Real-Time PCR System (Roche ...