Labshake search
Citations for Roche :
1301 - 1350 of 3664 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... The first-strand cDNA was synthesized from 2 μg of total RNA with an anchored-oligo (dT)18 primer using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription was done with the first Strand synthesis kit (Fermentas) using oligo (dT)18 as a primer and qPCR was carried out with LightCycler 96 (Roche) using GAPDH.
-
bioRxiv - Developmental Biology 2021Quote: ... qPCR analysis was performed using primers detailed in Supplementary file 7 on a Roche Lightcycler 480 II (Roche Holding AG) using LightCycler 480 SYBR Green I Master mix (Roche Holding AG ...
-
bioRxiv - Molecular Biology 2020Quote: The following mutations were introduced into pcDNA4/TO-ORF24-3xFLAG using two primer site-directed mutagenesis with KAPA HiFi polymerase (Roche): L73A (Addgene #138426) ...
-
bioRxiv - Molecular Biology 2020Quote: ... targeting the HBV_circ_1 B site was labelled with DIG-11-dUTP by digoxin using a Dig high primer DNA labelling kit and detection starter kit II (Roche). Hepatic tissue paraffin sections of HCC patients were treated with dewaxing and then digested with protease K ...
-
bioRxiv - Cell Biology 2020Quote: ... The region around the E-Box was amplified with primers outside of the homology regions using Kappa HiFi HotStart ReadyMix (Roche) and cloned into pCR-Blunt II-TOPO (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 pmol of the forward and reverse gene-specific primers each in Light Cycler SYBR Green I Master mix (Roche) on LightCycler 480 II (Roche) ...
-
bioRxiv - Developmental Biology 2021Quote: ... A T7 RNA polymerase binding site with short 5’-tail (aaaaTAATACGACTCACTATAG) was added to reverse primers for transcription using T7 RNA polymerase incorporating DIG labelled ribonucleotides (NEB, Roche). PCR amplified probe templates were confirmed by sanger sequencing.
-
bioRxiv - Molecular Biology 2021Quote: ... Sublibrary oligo pools were amplified individually using window-specific primer pairs and KAPA HiFi HotStart ReadyMix (Roche, Indianapolis, IN, USA) with a final template concentration of 1:2000 resuspended oligo array and annealing temperatures of either 60 °C or 65 °C (depending on performance of individual primer pairs ...
-
bioRxiv - Molecular Biology 2021Quote: SNSs prepared as described above were converted to double-stranded DNA (dsDNA) via random priming with random hexamer primer phosphate (Roche) and ligation with Taq DNA ligase (NEB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... forward and reverse primers for the genes of interest (see Supplemental table S2) were mixed with FastStart Universal SYBR Green Master (Rox; Roche). 5 µl of this mixture was pipetted in duplicate per condition in a 384 well plate ...
-
bioRxiv - Microbiology 2020Quote: ... was used for each time point (mid-log and stationary) along with gene-specific primer and SYBR Green master mix (Roche) in a 10 μL reaction according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCRs (for primers, see Supplemental Table S1) were performed with SYBR Green master mix (Ozyme) using a LightCycler 480 (Roche) and incubated for 2 min at 95°C with 35 cycles of 10 sec at 95°C ...
-
bioRxiv - Bioengineering 2019Quote: ... For molecular cloning 3 µg of RNA were reverse transcribed for 30 min at 50°C using an oligo(dT) primer and the Transcriptor High Fidelity cDNA Synthesis Kit (Roche) followed by 5 min enzyme inactivation at 85°C according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... The libraries were quantified using KAPA SYBR FAST qPCR Master mix with Illumina standards and primer premix (KAPA Biosystems, USA), and Qubit dsDNA HS kit on a Qubit 2.0 fluorometer (Life Technologies ...
-
bioRxiv - Plant Biology 2019Quote: ... 500 nM of each primer was applied and mixed with LightCycler 480 Sybr Green I Master mix (Roche Applied Science) for quantitative PCR analysis ...
-
bioRxiv - Systems Biology 2019Quote: ... qPCR was performed using the Taqman or SYBR green system with sequence-specific primers and/or the Universal Probe Library (Roche). All data were analyzed with 18S or β-actin as the endogenous control ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 0.25□µl forward and reverse primer (to a final concentration of 250□nM, IDT) and was analysed on the LC-480 device (Roche) for RT-qPCR cycling ...
-
bioRxiv - Microbiology 2021Quote: ... One to five ng of DNA was analyzed by qPCR using 300 nM primers and SYBRgreen Master mix (Roche AG) using a QuantStudio 7 Flex Real Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... first strand cDNA synthesis was performed using mRNA with an oligo-dT primer using Transcriptor High Fidelity cDNA Synthesis Kit (Roche), according to the manufacturer′s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... A total of 1 μg of total RNA was reverse-transcribed with oligo dT primers using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche) according to the manufacturer’s protocols ...
-
bioRxiv - Genomics 2020Quote: ... cDNAs were prepared using Superscript II reverse transcriptase (Life Sciences) using hexamer random primers and qPCR was performed using the SybrGreen aMster kit (Roche) on a LightCycler 480 II ...
-
bioRxiv - Cell Biology 2021Quote: ... and pBlueScript II KS reverse (5’-GCT GGG TCT CGT GGT TTC CCT TTA GTG AGG GTT AAT TG) primers and either 60 µM biotin-16-dUTP or digoxigenin-11-dUTP (Roche). This results in a 5 kb DNA tether which can be attached to a streptavidin coated magnetic bead at one end and an anti-digoxigenin coverslip surface at the other.
-
bioRxiv - Molecular Biology 2022Quote: ... All 11 μl eluted mRNA were reverse transcribed using random hexamer primers and Transcriptor First Strand cDNA Synthesis Kit (Roche) at 65°C for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... The primers detecting the different CEACAMs mRNAs and their splice variants were designed by the Universal ProbeLibrary Assay Design Center (Roche) and are listed in Supplementary Table 1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... where the reverse primer contains a T7 promoter sequence (in caps) for in vitro transcription using DIG labeling mixtures (Roche) and T7 RNA polymerase:
-
bioRxiv - Genomics 2019Quote: We amplified the Tug1 cDNA sequence with primers (see Sequences and Primers below) having KpnI and NotI restriction enzyme overhangs from the pTRE2-Tug1 vector plasmid using Q5 polymerase (Roche) and under following conditions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 pmol of the forward and reverse gene-specific primers each (Supplemental Table 3) in Light Cycler SYBR Green I Master mix (Roche) on LightCycler 480 II (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: MtDNA copy number was analyzed in duplicate by quantitative real-time PCR using 2 μl of 1/400-diluted SacI-treated total DNA in a 10 μl reaction containing 0.2 μM forward and reverse primers and 1× KAPA SYBR FAST qPCR Master Mix for LightCycler 480 (KAPA Biosystems) in a LightCycler 96 instrument (Roche) ...
-
bioRxiv - Genomics 2020Quote: ... Quantitative PCR reactions were prepared using the FastStart DNA Essential DNA Green Master and sequence-specific primers (Supplementary Table S3 and analyzed using a Roche Light Cycler®96 ...
-
bioRxiv - Genomics 2021Quote: ... or CJA144) and reverse indexing primers (JS409-412,JS470-477) using KAPA2G Robust HotStart ReadyMix with 0.5x SYBR green (Roche #04707516001) on a miniOpticon (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Physiology 2020Quote: ... Primers for genes of interest were designed by the Universal Probe Library Assay Design Centre (Roche Applied Science, Penzberg, Germany) and purchased from Eurofins MWG Operon (Ebersberg ...
-
bioRxiv - Physiology 2020Quote: 1 μg RNA was reverse transcribed into cDNA with Oligo(d)T primers using the Transcriptor First Strand cDNA Synthesis kit (Roche). The qRT-PCR was performed with the LightCycler 480 SYBR Green I Master mix (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... The target regions were amplified for each sample using the primer pools coupled with KAPA HiFi Hotstart readymix (KAPA Biosystems) using 20 µM primers as well as a 50/53 °C (Annealing temperature 1/2 ...
-
bioRxiv - Cell Biology 2019Quote: ... The qPCR reaction was carried out in 8 μl with a primer concentration of 1 μM and SYBR Green Master mix (Roche) in a Roche LightCycler 480 system ...
-
bioRxiv - Cancer Biology 2021Quote: Reverse transcription for qPCR analysis was done with the first strand synthesis kit (Fermentas) using oligo (dT)18 as a primer and qPCR was carried out with LightCycler 96 (Roche) using FastStart Essential DNA Green Master Mix (Roche) ...
-
bioRxiv - Microbiology 2021Quote: Fifteen nanograms of whole-cell DNA was analyzed by qPCR using 300 nM primers and SYBR green master mix (Roche). The reaction conditions consisted of a 15-min 95°C activation cycle ...
-
bioRxiv - Immunology 2020Quote: ... was amplified from cDNA using primers mPodoHindFor (GATCAAGCTTATGTGGACCGTGCCAGTGTTG) and mPodoFcRev (GATCGGATCCACTTACCTGTCAGGGTGACTACTGGCAAGCC) and was quantified by SYBR Green 1 mastermix (Roche) qPCR using a PCR thermocycler and normalised to unstimulated control.
-
bioRxiv - Molecular Biology 2021Quote: ... For RT-qPCR RNAs were reverse transcribed (Superscript II, Invitro-gen) using random primers and quantified by qPCR (Fast start SYBR green, Roche). Primer sequences are described below ...
-
bioRxiv - Genomics 2022Quote: ... Each ligation product was index-amplified using unique dual 8-bp indexing primers for eight cycles with KAPA HiFi polymerase (Roche).
-
bioRxiv - Developmental Biology 2022Quote: ... and 0.25 µM forward and reverse primers (Extended Data Table 1) on a LightCycler 480/II 384 (Roche, serial #6073). Four technical replicates were performed per biological replicate qPCR primer set ...
-
TOR acts as metabolic gatekeeper for auxin-dependent lateral root initiation in Arabidopsis thalianabioRxiv - Plant Biology 2022Quote: ... was performed using gene specific primers (see File S2) in a total volume of 10 μl SYBR Green Master mix (Roche) on a LightCycler LC480 apparatus (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... The identified cdkd;3-3 mutation was genotyped by the High-Resolution Melting (HRM) qPCR-based method using primers described in Table S3 using Lightcycler96 thermocycler (Roche) using the inbuilt HRM profile.
-
bioRxiv - Cancer Biology 2022Quote: ... followed by DNA purification and amplification for the library with index primers using KAPA HiFi HotStart Kit (Roche, Indianapolis, IN). The libraries were purified ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... The quantity of WSSV genome copies was measured by absolute q-PCR using the primers of WSSV-F/R and a TaqMan fluorogenic probe named TaqMan probe-WSSV via LightCycler TaqMan Master kit (Roche) as described previously (Supplementary Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 20μL reverse transcription product was diluted with 60μL of Invitrogen nuclease free water and analyzed using sequence-specific qPCR primers and probes (Integrated DNA Technologies) and Light Cycler 480 Probes Master Mix (Roche) for relative quantitation of RNA on a CFX96 Touch real-time PCR detection system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting NGS adapter ligated cDNA was then amplified with KAPA HiFi HotStart ReadyMix using NGS indexing primers for 25 cycles (ROCHE). Amplified DNA fragments between 150∼500nt were size selected by gel extraction purification following gel-electrophoresis in a 4% SYBR-GOLD E-GEL ...
-
bioRxiv - Microbiology 2023Quote: ... the specified primer concentrations and 2X SYBR Green I Master Mix solution (LightCycler® 480 SYBR Green I Master, Roche). Standard curves were generated from known concentrations of 10-fold serial diluted DNA from B ...
-
bioRxiv - Plant Biology 2023Quote: ... Reactions of qRT-PCR were set up with 50-70ng of cDNA and 250 nM gene-specific primers using FastStart Universal Sybr Green Master (Rox) mix (Roche). Fold change in transcript levels for deregulated genes was calculated as follows ...