Labshake search
Citations for Roche :
1601 - 1650 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... in a total volume of 6 μL containing 0.5 mM of each specific primer and 3 μl of SYBR Green I Master Mix (Roche Applied Science). The second derivative maximum method was used to determine Cp values and PCR efficiencies were determined using LinRegPCR software (http://LinRegPCR.nl) ...
-
bioRxiv - Genomics 2019Quote: We amplified 5 ng of the HSS library with the following primers: STARR-Seq-AG-f and STARR-Seq-AG-r (Supplemental Table 8) using KAPA HiFi 2x Readymix (Kapa Biosystems) with a 65 °C annealing temperature and 30 s extension ...
-
bioRxiv - Genomics 2019Quote: ... Final libraries were run on the Fragment Analyzer to assess their size distribution and quantified by qPCR with adapter specific primers (Kapa Biosystems). The libraries were pooled together based on expected final coverage and sequenced across multiple flow cell lanes to reduce impact of lane-to-lane variations in yield ...
-
bioRxiv - Developmental Biology 2021Quote: ... was carried out using 10 ng of cDNA and 100 nM of each primer pair with a Roche LightCycler 480 machine and LightCycler 480 SYBR Green I Master 2X (Roche, 04887352001). The PCR program was ...
-
bioRxiv - Microbiology 2020Quote: ... ifn-β and bcl-2 genes were amplified with specific primers and quantified by qPCR using a LightCycler 96 system (Roche). The mRNA levels of il-6 ...
-
bioRxiv - Immunology 2020Quote: ... The specific primers for each target (listed below) and probes were designed by Universal ProbeLibrary Assay Design Center (Roche Applied Science). Primers used in this study were 5′-CCCTCTCTTTATCAACAAACTTGC-3′ and 5′-TTGTTTTCATGTTGGACCAGA-3′ for IFN-α ...
-
bioRxiv - Microbiology 2022Quote: ... PCR enrichment of fragments containing transposon sequence was then carried out using transposon- and adaptor-specific primers using Kapa HiFi HotStart ReadyMix (Kapa Biosystems) for 10 to 20 cycles ...
-
bioRxiv - Microbiology 2022Quote: ... with the IDT E Assay First Line Screening primers and probe (Cat # 10006804) on a LightCycler 96 System (Roche, Cat# 05815916001).
-
bioRxiv - Microbiology 2023Quote: ... The qPCR experiments were performed using specific oligonucleotide primers and hot-start polymerase (SYBR Green Fast Master Mix; Roche Diagnostics, Germany). The amplification cycles were performed using a C1000 Touch Thermal cycler (Biorad ...
-
bioRxiv - Immunology 2023Quote: ... the genomic library was fully amplified using the SYBR qPCR Master Mix with primers included in the Illumina Library Quantification kit for Bio-Rad iCycler (KAPA Biosystems). Libraries were sequenced on the Illumina NextSeq 2000 using 60-nt paired-end Illumina chemistry ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 12–17µL of resulting libraries were amplified using the NEBNext Illumina primers (that came with the multiplex oligos) and the KAPA Library Amplification Kit (KK2611, Roche Diagnostics) in two separate PCR reactions with 15-17 cycles ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µg of RNA was reverse-transcribed using the Transcriptor First Strand cDNA Synthesis Kit with random hexamer primers (Roche, 04379012001), and a 370-bp fragment (nucleotides 1304- 1673 of NM_010610.3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The V4–V5 regions of 16S rRNA gene were amplified using specific primers and libraries were constructed using the Hyper Library Preparation Kit from Kapa Biosystems (Roche Diagnostics ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions were set up in 384-well plates by mixing serial dilutions of each reverse-transcribed sample with the appropriate primer pairs (each primer used at a 0.25 µM final concentration) and the LightCycler 480 SYBR Green I Master Mix (Roche Applied Science). Real-time qPCR was carried out in a LightCycler 480 Instrument (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA expression of melanocytic markers and PD-L1 was determined using intron-spanning primers with SYBR FAST qPCR master mix (Kapa Biosystems). qRT-PCR was performed with the following primers ...
-
bioRxiv - Genomics 2024Quote: ... an inverse PCR was performed on attB-EGFP-PTEN-IRES-mCherry-562bgl with primers NP0207 and NP0325 to remove EGFP-PTEN and create compatible Gibson overhangs using Kapa HiFi polymerase (Kapa Biosystems). A gBlock (NPg0007 ...
-
bioRxiv - Microbiology 2024Quote: ... The qPCR experiments were performed using specific oligonucleotide primers previously described[24] and hot-start polymerase (SYBR Green Fast Master Mix; Roche Diagnostics). The amplification cycles were performed using a C1000 Touch Thermal cycler (Biorad) ...
-
bioRxiv - Plant Biology 2020Quote: ... and identified by morphological features.41 Polymerase chain reaction (PCR) products were purified with the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany), and sequenced in both directions by Macrogen Inc ...
-
bioRxiv - Developmental Biology 2021Quote: The genomic region of spe-51 was amplified by PCR from N2 genomic DNA using the Expand Long Template PCR system from Roche (Catalog Number 11681834001). The following primers were used ...
-
bioRxiv - Immunology 2021Quote: ... Ct values for Asns and the housekeeping gene Actb (Beta-actin) were determined by quantitative real-time PCR on a LightCycler® 480 II Real-Time PCR System (Roche Life Science), using the TB Green™ Premix Ex Taq™ (Takara ...
-
bioRxiv - Bioengineering 2021Quote: ... the quantitative real-time PCR (qRT-PCR) reactions were carried out using the KAPA SYBR FAST qPCR kit from Kapa Biosystems (MA, USA) with sfGFP-specific primer sets (Supplementary Table 4) ...
-
bioRxiv - Plant Biology 2021Quote: ... Digoxigenin-11-dUTP (DIG) labeled DNA probes were generated using via PCR labelling using PCR DIG Probe Synthesis kit (Roche, catalogue no. 11636090910). 10 ng of purified plasmid DNA containing full length GFP DNA was used as PCR template and amplified with GFP forward (TCAAGGACGACGGGAACTACAAG ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR reactions were performed using 50 ng of metagenomic DNA per sample using the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, USA). The individual PCR reactions were performed in 20 µL final volume and containing 4 µL of 5X Kapa HiFi Buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... The cDNA was diluted 20-fold and used for qRT-PCR employing a LightCycler® 480 SYBR Green 1 Master PCR labelling kit (Roche Applied Sciences) and RotorGene 3000 Real time PCR machine (Corbett Research ...
-
bioRxiv - Zoology 2019Quote: ... PCR products were visualized on a 1.5% agarose gel and cleaned using the HiPure PCR product Cleanup kit (Roche Life Sciences, Indianapolis, IN) and sent for sequencing at Macrogen USA (Rockville ...
-
bioRxiv - Genetics 2022Quote: ... q-PCR was carried out using the PCR Biosystems Sygreen Blue Mix Separat -ROX (Cat. No. 17-507DB) in a LightCycler 480 Real-Time PCR system (Roche Diagnostics Corp., IN). Quantification was performed using the comparative ΔΔCt method and normalization for internal reference was done using either act-5 or pmp-2 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products were purified by using a High Pure PCR product purification kit (B A High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany), and purified products were sequenced directly using an ABI BigDye Terminator Cycle Sequencing Kit ver ...
-
bioRxiv - Cancer Biology 2023Quote: Real-time quantitative PCR (qPCR) was performed in accordance with MIQE-guidelines (15) using a LightCycler® 480 Real-Time PCR Instrument (Roche, Mannheim, Germany) in a 384-well plate format ...
-
bioRxiv - Immunology 2021Quote: ... ATAC-seq libraries were amplified using 5 μl each of the i5 and i7 Nextera Indexing primers and 25 μl of 2x HiFi HotStart ReadyMix (Roche Diagnostics, KK2601). Final libraries were purified using 1x volumes of AMPureXP SPRI-beads and sequence using 75bp paired-end reads on an Illumina NextSeq500.
-
bioRxiv - Genomics 2022Quote: ... 1 μl 10 μM reverse primer with different 6-nt index sequence (barcode) and 10 μl 2X KAPA HiFi HotStart ReadyMix (KAPA Biosystems, KK2602), was performed using 95 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and amplified using a reporter specific forward primer with illumina sequencing adaptors and a reverse primer binding the partial illumina read 1 sequence with the remaining sequencing adaptors using Kapa HiFi HotStart DNA Polymerase (Kapa Biosystems, #KK2601) using 18X cycles for GFP and 23X for Firefly reporter ...
-
bioRxiv - Immunology 2021Quote: ... NGS libraries were generated following a two-step primer extension protocol.70 30 μg of plasmid DNA were amplified using Kapa Hifi HotStart Ready mix (Kapa Biosystems, KK2602) in a 50 μl reaction using primers EpMap_7 and EpMap_8 (which bound to regions that were ~70 bp away from the peptide encoding region ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µl of RCA product was used as a template with specific primer pairs and Kapa Hifi Hotstart Ready Mix (Kapa Biosystems, USA) using the following thermal cycling protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Primer were designed using the Primer-BLAST tool on the NCBI website and relative quantification of cDNA was evaluated using SYBR-Green (Roche, Cat#: 04707516001) and a Roche LightCycler 480 Instrument II ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Biochemistry 2022Quote: ... HT-SELEX libraries were pooled in equimolar amounts and contaminating primers were eliminated by performing a clean-up with KAPA Pure beads (Roche cat. 07983271001), using a 3x beads-to-sample ratio ...
-
bioRxiv - Microbiology 2020Quote: ... The qRT-PCR analysis was performed with the oligonucleotide primers listed in STAR Methods and SYBR Green I Master reagents with a LightCycler® 480 Instrument II (Roche Diagnostics). The final volume was 5 µL in a 384-well plate ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg of RNA was converted to cDNA using an oligo dT primer and the Transcriptor First Strand cDNA Synthesis kit (Roche Molecular Systems). qPCR was performed using PowerUp SYBR Green (Applied Biosystems Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 0.5 µM forward and reverse primers were mixed with LightCycler® 480 SYBR Green I Master Mix (Roche 04 707 516 001) and 25x diluted cDNA for real-time PCR ...
-
bioRxiv - Cancer Biology 2019Quote: ... Clones were screened for knockout of target genes by Western Blot and/or by allelic sequencing with custom primers (Integrated DNA Technologies; Table S2) after processing genomic DNA with the KAPA Mouse Genotyping Kit (KAPA Biosystems KK7352) and TOPO TA Cloning Kit (Thermo Fisher Scientific K457501).
-
bioRxiv - Developmental Biology 2020Quote: ... Starting concentration of the target transcripts were calculated according to the absolute quantification method with primer efficiency correction based on the titration curve for each target gene using the LightCycler 480 Software (Roche; version 1.5) and normalized against the geometric mean of the reference genes HvActin ...
-
bioRxiv - Immunology 2020Quote: RNA was reverse-transcribed with random DNA hexamers and oligo-dT primers using material and methods provided with the Transcriptor First Strand cDNA Synthesis (Roche, Indianapolis, IN). PCR typically employed 35 cycles of amplification and an annealing temperature of 60°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the product was used for the second round PCR using the primers F and R-T7 for generating antisense probe and primers R and F-T7 for generating sense probe used in ISH assays with the DIG RNA Labeling Kit (Roche, Mannheim, Germany),the primers were shown in table 1 ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR was performed using gene-specific primers (Supplemental Table S3) using Promega Go Taq® qPCR Master Mix on a Light Cycler 480 II® (Roche) thermocycler ...
-
bioRxiv - Genomics 2023Quote: ... Illumina-compatible sequencing libraries were prepared from 20 ng of purified DNA in 50 μL of TE buffer using the KAPA Hyperprep Kit with Library Amplification Primer Mix (Roche, CAT #07962363001) and 6 cycles of PCR amplification ...
-
bioRxiv - Cancer Biology 2022Quote: ... Real-time quantitative PCR was performed using gene-specific qPCR primers listed in Supplementary Materials and the KAPA SYBR Fast qPCR Master Mix (2X) kit (Kapa Biosystems, #KK4602), and ran on CFX96 Real-Time PCR Detection System (BIO-RAD ...
-
bioRxiv - Cancer Biology 2023Quote: ... For gene expression analysis, appropriate primers (metabion international AG, Germany) and LightCycler® 480 SYBR® Green I Master (Roche, Mannheim, Germany) were used ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was reverse transcribed using a TransScript Uni All-in-One (TransGen Biotech, Beijing, China) and reacted with specific primers using a FastStart Universal SYBR Green Master Mix (ROX) (Roche, Switzerland, Basel) and Bio-Rad CFX96 (Bio-Rad Laboratories ...
-
bioRxiv - Developmental Biology 2024Quote: ... Real-time fluorescence-monitored quantitative PCR using the primer pair 5′-CCTATC ACCCTTGCCA-3′ and 5′-GAGGCTGTTGCTTGTG-3′ was performed on a LightCycler 96 System (Roche, Basel, Switzerland). Each reaction of 20 µL consisted of 10 µL of SYBR Green I (Roche) ...
-
bioRxiv - Plant Biology 2024Quote: Converted DNA was amplified for 23 cycles using U1 and U2 primers and KAPA HiFi HotStart Uracil+ DNA polymerase (Roche, Pleasanton, USA), according to the manufacturer’s instructions ...