Labshake search
Citations for Roche :
1151 - 1200 of 3664 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... RT-qPCR was performed in triplicates using the one-step system Lightcycler 480 RNA Master Hydrolysis Probes (Roche), with the following PCR profile ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR were performed using the LightCycler 480 SYBR Green I Master Kit on a LightCycler480 apparatus (Roche) using standard protocols (40 cycles ...
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR of the RT cDNA was performed according to the manufacturer’s instructions in a LightCycler 480 II (Roche Life Science using SYBR GREEN (Roche Life Science ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using SYBR Green qPCR Master Mix (TOYOBO, QST-100) in the LightCycler480 system (Roche). The constitutively expressed tubulin gene (MGG_00604 ...
-
bioRxiv - Physiology 2023Quote: ... Real-time quantitative polymerase chain reaction (RT-qPCR) was carried out in a LightCycler 480 detection system (Roche) using the LightCycler FastStart DNA Master plus SYBR Green I kit (Roche) ...
-
bioRxiv - Cell Biology 2024Quote: ... and the fixed cells were then resuspended in 1 ml RT vPBS containing EDTA-free protease inhibitor (Roche). The cells were attached to the coverslips by centrifugation (1000 x g ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR was performed according to protocols provided by the manufacturer using FastStart Essential DNA Green Master (Roche) and LightCycler96 (Roche ...
-
bioRxiv - Plant Biology 2020Quote: Primers that were first used in this study were designed using either the ‘Universal ProbeLibrary Assay Design Center’ (Roche) or ‘primer-blast’ (NCBI) ...
-
bioRxiv - Molecular Biology 2021Quote: MtDNA copy number was analyzed in duplicate by quantitative real-time PCR using 1 μl of 1/200-diluted DNA in a 20 μl reaction containing 0.2 μM forward and reverse primers and 10 μl of 2x SyGreen Mix (qPCRBIO #PB20.14-05) in a LightCycler 96 instrument (Roche). Primer pairs targeting cytochrome B (nt 14,682–14,771 of mtDNA ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 nM target-specific primers (Table S5) and LightCycler 480 SYBR Green I Master (Roche Molecular Systems, Pleasanton, CA) in the LightCycler 480 II detection system (Roche Molecular Systems ...
-
bioRxiv - Plant Biology 2021Quote: ... 500 nM of each primers and 5 μl of 2X LightCycler® 480 SYBR Green I Master mix (Roche) in 10 μl final volume ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The levels of GAPDH and CYP1A1 mRNAs were determined using probes and primers from Universal Probes Library (UPL; Roche). GAPDH–UPL60 ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).
-
bioRxiv - Molecular Biology 2019Quote: ... Purified products were subjected to second strand synthesis using 0.3 µM of second strand biotinylated primer and the KAPA Hi-Fi hot start ready mix (KK2601, Roche). The second strand reaction was carried out at 95 °C for 3 minutes ...
-
The Arabidopsis F-box protein FBW2 degrades AGO1 to avoid spurious loading of illegitimate small RNAbioRxiv - Cell Biology 2021Quote: ... PCR was performed using gene specific primers (see Table S3) in a total volume of 10μl SYBR Green Master mix (Roche) on a LightCycler LC480 apparatus (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: 500 ng of DNase-treated RNA was retrotranscribed into cDNA using random hexamers as primers according to the manufacturer’s protocol (Roche Transcriptor High Fidelity cDNA Synthesis Kit) ...
-
bioRxiv - Genomics 2021Quote: ... a junction PCR was performed using an intron-spanning primer pair (Junction_fwd and Junction_rev) and 8 μl cDNA with the KAPA HotStart HiFi Ready Mix (KAPA Biosystems) for 15 cycles ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized using the Transcriptor First-Strand cDNA Synthesis Kit with anchored oligo (dT)18 primers (Roche; 04379012001). Gene expression levels were analyzed by real-time PCR on an Applied Biosystems model 7500 Software (version 2.0.5 ...
-
bioRxiv - Genomics 2022Quote: ... and qPCR using KAPA SYBR FAST qPCR master mix with primer premix and Illumina standards (KAPA Biosystems, United States). The library size was estimated on Agilent Bioanalyzer 2100 using high sensitivity DNA kit (Agilent ...
-
bioRxiv - Plant Biology 2024Quote: ... 100 nM of each forward and reverse primer (Supplementary Table S4) and 125lllng λ-DNA (Roche Diagnostics, Vilvoorde, Belgium) was mixed with 2lllμL of a 12x diluted sample cDNA ...
-
bioRxiv - Neuroscience 2024Quote: ... .5 µL of a 10 µM primer mix and 7.5 µL of Fast Start SYBR Green Master Mix (Roche). Each reaction was performed in triplicate ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 ng amplified DNA and 1 μM forward and reverse primers and run on a LightCycler 480 machine (Roche) using the following protocol ...
-
bioRxiv - Developmental Biology 2021Quote: Mice ear notches or embryo tail tips were genotyped by PCR using Kapa2G Robust HotStart PCR Kit (Kapa Biosystems, KK5517) and Lbx1 primers (Table S1) ...
-
bioRxiv - Biochemistry 2022Quote: ... Primers were generated by www.leishgedit.net (Table S5) and all PCR reactions were performed using Expand High Fidelity PCR System (Roche, Basel, Switzerland), pooled and purified using PCR purification kits ...
-
bioRxiv - Microbiology 2019Quote: ... PCR amplicons were purified using the High Pure PCR Product Purification Kit of ROCHE™ (Roche Diagnostics Gmb, Mannheim, Germany). Sequencing was performed using MiSeq™ Illumina® (2 x 300 bp ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR was performed using 96-well white PCR plates using the LightCycler® 480 II system (Roche Applied Science, Germany). The amplification started with an initial denaturation step at 95°C for 5 min ...
-
bioRxiv - Bioengineering 2019Quote: ... the entire miniprepped volume was used as template in a PCR reaction using the KAPA HiFi PCR Kit (Kapa Biosystems). A ten-fold dilution of this PCR product was used as template in a barcoding PCR adding Illumina adapter sequences and dual barcodes ...
-
bioRxiv - Cancer Biology 2021Quote: Four consecutive and non-overlapping fragments from the pSP64 HPV16 bacterial artificial chromosome were PCR amplified using the Expand High Fidelity PCR system (Roche). This resulted in complete coverage of the HPV16 genome ...
-
bioRxiv - Physiology 2021Quote: ... mRNA expression levels were measured after reverse transcription by quantitative real-time PCR (qRT-PCR) with FastStart SYBR Green master mix (Roche) using a LC480 instrument (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... The attB-flanked hFGD4 fragment was produced by PCR using the “Expand High Fidelity Plus PCR System” (#3300226001, Roche, Switzerland) and the following primers ...
-
bioRxiv - Systems Biology 2022Quote: ... PCR was immediately performed by adding 6ul of PCR mix to each well (2ul Kapa HiFi Hotstart buffer (5x, Roche), dNTPs 0.12ul (25mM/each ...
-
bioRxiv - Developmental Biology 2022Quote: ... The cDNAs were used for the quantitative PCR assay on a LightCycler 480 Real-Time PCR System using the SYBR Green I Master mix (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCR optimisation was carried out on the full-length cDNA using the KAPA HiFi PCR kit (Kapa Biosystems, Boston USA) and 12 cycles was sufficient to generate the material required for SMRTbell library preparation ...
-
bioRxiv - Plant Biology 2021Quote: ... 50 ng of DNA was subjected to PCR amplification using the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, USA). The individual PCR reactions were performed in 20 μL final volume and contained:
-
bioRxiv - Microbiology 2022Quote: ... Relative mRNA quantitation was done using the SYBR green quantitative real-time PCR (qRT-PCR) master mix (Roche, Basel, Switzerland) using specific primers (Table S3) ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real-time PCR (qRT-PCR) was performed with the LightCycler 480 SYBR Green I Master kit (Cat. 04887352001, Roche). Primers for pmp-3 and ACTIN were used as housekeeping for C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We generated standard PCR-free Illumina paired-end sequencing libraries using KAPA Hyper PCR-free library reagents (KK8505, KAPA Biosystems) in Beckman robotic workstations (Biomek FX and FXp models) ...
-
bioRxiv - Genetics 2019Quote: ... The PCR reactions were performed on the Access Array System (Fluidigm) using KAPA2G 5X Fast Multiplex PCR Mix (Kapa Biosystems). Barcodes were added in a second round of PCR using Phusion DNA polymerase (NEB cat ...
-
bioRxiv - Cancer Biology 2020Quote: A unique Fluidigm barcode was added to each sample by PCR in 10 μl reactions using the Fast Start High Fidelity PCR System (Roche) containing ...
-
bioRxiv - Biochemistry 2019Quote: ... the collected cDNA solution was used for qRT-PCR using Power SYBR® Green PCR Master Mix (Roche, Indianapolis, USA) according to the schemes of the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: Alkali-labile digoxigenin labelled deoxyuridine triphosphate (DIG-dUTP) was incorporated in Southern blot probes by PCR using PCR DIG Probe Synthesis kit (Roche) with the following specifications (refer to sequences in Supplementary table 3) ...
-
bioRxiv - Physiology 2020Quote: ... mRNA expression was measured after reverse transcription by quantitative real-time PCR (qRT-PCR) with FastStart SYBR Green master mix (Roche) using a LightCycler Nano or LC480 instruments (Roche) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Each of these pools was amplified in a 50 μl PCR reaction using Kapa HiFi HotStart PCR Mix (Kapa Biosystems), 40 ng of synthesized oligonucleotide as template and pool-specific primers ...
-
bioRxiv - Physiology 2021Quote: ... Fluorescence-based quantitative real-time PCR (qRT-PCR) was then performed using the FastStart Universal SYBR Green Master mix (4913850001; Roche) and a Rotor-Gene Q instrument (Invitrogen) ...
-
bioRxiv - Genomics 2021Quote: ... The oligonucleotides were used as PCR templates and amplified by six rounds of PCR using KAPA HiFi polymerase (Kapa Biosystems) and primers F_N50_lib and R_N50_lib ...
-
bioRxiv - Cancer Biology 2019Quote: ... Real-time PCR was done using SYBR Green Realtime PCR Master Mix (TOYOBO, Osaka, Japan) on a LightCycler 480 Real Time PCR system (Roche).
-
bioRxiv - Cell Biology 2020Quote: Global amplification of the cDNA by PCR was then performed by adding PCR mastermix consisting of: 12.5ul 2x KAPA HiFi HotStart ReadyMix (KAPA Biosystems), 0.25ul 10mM Smart PCR primer ...