Labshake search
Citations for Roche :
1451 - 1500 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: A total of 1.0 µg of extracted DNA was used for PCR-free library construction using the KAPA HyperPrep PCR-Free Library Prep kit (Roche, KK8505). Mechanical shearing using the Covaris microtube system (Covaris ...
-
bioRxiv - Cancer Biology 2024Quote: ... all extracted genomes were used as the PCR templates and the sgRNA-coding sequences with iBAR were amplified using KAPA HiFi HotStart ReadyMix PCR kit (Roche, #KK2631). The DNA amplification was performed under the following condition ...
-
bioRxiv - Cancer Biology 2019Quote: ... qRT-PCR was performed using LightCycler 480 SYBR Green I Master Mix on a LightCycler 480 Real-Time PCR System (Roche, Mannheim, Germany). Relative expression was calculated based on the 2−ΔΔCt method and GAPDH was used as the internal control ...
-
bioRxiv - Physiology 2021Quote: ... a 6.7 kb DNA fragment starting 1 kb upstream of murine Gnrhr exon 3 was amplified by PCR using the Expand Long Template PCR System (Roche, Basel, Switzerland) from 129SvEv genomic DNA using primers incorporating 5’ XmaI and 3’ NotI restriction enzyme sites (Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification of 16S rRNA genes was conducted using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA, USA) in a total volume of 25 μl containing inner primer pairs (50 nM each ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification of the 16S rRNA gene was performed using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, MA, USA) with an inner primer pair (50 nM for each ...
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... A master mix was made for each qRT-PCR target containing 5 ul of KAPA Universal SYBR Fast PCR mix (KAPA Biosystems, #KK4602), 0.6ul of 5 uM forward primer ...
-
bioRxiv - Microbiology 2022Quote: ... The agtA gene disruption cassette was generated by fusion PCR using an Expand High Fidelity PCR System (F. Hoffmann-La Roche, Basel, Switzerland). The 5′- and 3′-arms of agtA were amplified from wild-type A ...
-
bioRxiv - Microbiology 2019Quote: ... The V3-V4 region of the 16S rRNA gene was PCR amplified using the KAPA HotStart PCR Kit (Kapa Biosystems, Wilmington, MA) with 10 µL Kappa HotStart Mastermix ...
-
bioRxiv - Synthetic Biology 2020Quote: ... taiwanensis VLB120 was used as the template for the PCR and was isolated using the High Pure PCR Template Preparation Kit (Hoffmann-La-Roche, Basel, Switzerland). Plasmids were constructed by Gibson assembly using the NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Immunology 2021Quote: ... 5 μl of the resulting cDNA-containing reverse transcription mixes were then used as templates for 25 μL PCR reactions using the KAPA HiFi PCR kit with GC buffer (Roche Diagnostics, #07958846001) and the following thermal cycling conditions ...
-
bioRxiv - Immunology 2020Quote: ... and 0.1 μl to 0.2 μl of cDNA generated were analyzed by SYBR Green-based real time PCR (real time-PCR) (Roche Diagnostics, Laval, QC) using 300 nM of gene-specific primers ...
-
bioRxiv - Genetics 2022Quote: ... Quantitative PCR was performed in 4 replicates in final volume of 10 µL using Light SYBR Green PCR Master Mix (Roche, Applied Science) on a LightCycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA fragments were amplified using the Kapa HiFi Hotstart Uracil+ PCR mix in 14 cycles of PCR (Kapa Biosystems, Wilmington, MA, USA). Bisulfite libraries were sequenced on an Illumina HiSeq3000 instrument (150 bp paired-end reads).
-
Gut microbial disruption in critically ill patients with COVID-19 associated pulmonary aspergillosisbioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 infection was confirmed by quantitative reverse transcription PCR (TaqMan™-PCR performed on Roche cobas® 6800, Basel, Switzerland), performed on nasopharyngeal swabs or tracheal fluid ...
-
bioRxiv - Microbiology 2022Quote: ... then guide sequences were amplified from gDNA and the plasmid pool by nested PCR using KAPA HIFI Hotstart PCR kit (Kapa Biosystems, KK2501), as previously described in (Young et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... Templates were amplified in KOD SYBR qRT-PCR Mix (TOYOBO) using a Light Cycler Nano Real-time PCR Detection System (Roche Applied Science). The PCR was performed according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The relative expression levels were determined by performing a quantitative reverse transcription PCR (qRT-PCR) analysis using a LightCycler 480 system (Roche, Basel, Sweitzer) with an Evo M-MLV RT-PCR kit (Accurate Biotechnology Co. ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cDNA inserts of the plasmids were isolated and amplified by low-cycle (12x) PCR using a Kapa2G Robust Hotstart PCR kit (Roche, Ref #07961073001) according to specifications ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplification was performed using KAPA HiFi (Roche KK2101) for all amplifications with plasmid or phage templates ...
-
bioRxiv - Genetics 2021Quote: ... PCR with Kapa HiFi HotStart ReadyMix (Roche, Basel, Switzerland) was performed on the cDNA using M28 virus-specific primer pairs ...
-
bioRxiv - Developmental Biology 2021Quote: ... using SYBRgreen PCR master mix (Kapa Biosystems, London, UK). 21.5 ng of cDNA were loaded ...
-
bioRxiv - Immunology 2019Quote: ... on the Roche real-time PCR system (Roche 480). Values were normalized to Rps17 gene for each sample ...
-
bioRxiv - Molecular Biology 2021Quote: Using the LightCycler 96 Real-Time PCR System (Roche), the following cycling conditions were used ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative PCR was performed using a LightCycler (Roche Diagnostics). UBQ14 (for VISUAL experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... on a LightCycler® Real-Time PCR System (Roche). The final volume for each reaction was 20 μl with 500 nM of corresponding gene specific primers (Snhg11 forward primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... using either 480 SYBR Green LightCycler PCR mix (Roche), SsoAdvanced Universal SYBR mix (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1x FastStart PCR Buffer including 2 μM MgCl2 (Roche), 0.05 mm dNTPs (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... Using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems) the two 5’UTRs were amplified from cDNA.
-
bioRxiv - Developmental Biology 2019Quote: ... using a LightCycler 480 Real-Time PCR System (Roche). The relative expression level of each target gene was determined using glyceraldehyde-3 phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Microbiology 2019Quote: ... The LightCycler 480 Real-Time PCR System (Roche Diagnostics) was used for thermal cycling ...
-
bioRxiv - Genetics 2019Quote: ... PCR reactions included 5µL HiFi HotStart ReadyMix (KAPA Biosystems), 3.2µL primer mix (1.25µM) ...
-
bioRxiv - Genomics 2020Quote: ... Seven cycles of PCR using HiFi polymerase (Kapa Biosystems) was used to enrich the bisulfite converted DNA and introduce fault tolerant hexamer barcode sequences ...
-
bioRxiv - Cancer Biology 2021Quote: ... real time quantitative PCR using sybr-green (Kapa Biosystems) and the StepOnePlus™ Real-Time PCR Systems (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative PCR was performed using FastStart SYBR Green (Roche) on a Lightcycler 480 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and Expand High Fidelity PCR System (Roche Life Science) according to manufacturer’s protocols ...
-
bioRxiv - Genetics 2021Quote: ... qRT-PCR was performed with SYBR Green reagent (Roche) using Lightcycler 480 (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... performed using the ExpandTM High Fidelity PCR system (Roche), would yield an amplicon ...
-
bioRxiv - Cell Biology 2021Quote: ... We used the PCR DIG Probe Synthesis Kit (Roche) for DIG-labeled probe production ...
-
bioRxiv - Physiology 2022Quote: ... qRT-PCR was run on LightCycler 96 System (Roche).
-
bioRxiv - Neuroscience 2022Quote: ... using the SYBR Green PCR Master Mix (Roche, Switzerland) on a ViiA7 Real-Time PCR system (Applied Biosystems ...
-
The transcription factor RUNX2 drives the generation of human NK cells and promotes tissue residencybioRxiv - Immunology 2022Quote: ... on the LightCycler 480 real-time PCR system (Roche). Relative gene expression was determined using GAPDH and either TBP or actin-β as housekeeping genes ...
-
bioRxiv - Developmental Biology 2020Quote: ... on a LightCycler 480 real-time PCR system (Roche). The values obtained were normalized to Gapdh levels ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed using SYBR Green master (Roche) and PCR amplification was monitored in real-time using LightCycler-480 Instrument ...
-
bioRxiv - Molecular Biology 2022Quote: ... performed using an Expand High Fidelity PCR system (Roche), would yield an amplicon ...
-
bioRxiv - Genetics 2022Quote: ... using the PCR-DIG Probe Synthesis Kit (Roche Diagnostics). FISH was performed as described by Huang et al (Huang et al ...
-
bioRxiv - Genomics 2022Quote: ... on a LightCycler 480 Real-Time PCR System (Roche) using either 96-well or 384-well qPCR plates ...
-
bioRxiv - Microbiology 2019Quote: ... PCR reaction was carried out in LightCycler 96 (Roche) for 45 cycles of denaturation at 94 °C for 5 s,annealing at 55 °C for 15 s,and extension at 72°C for 1 min ...
-
bioRxiv - Microbiology 2019Quote: ... on a LightCycler 96 real-time PCR system (Roche) (for primers ...