Labshake search
Citations for Agilent :
1451 - 1500 of 1579 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: Quantitative PCR (qPCR) was carried out in a 25 μL reaction volume using the Brilliant II SYBR Green PCR Master Mix (Stratagene, Agilent technologies). Primer concentrations were set at 0.2 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... and RNA quality analyzed using Agilent 2100 Bioanalyzer RNA 6000 Nano Reagent using the Eukaryote Total RNA Nano Series II assay (Agilent Technologies Inc).
-
bioRxiv - Molecular Biology 2024Quote: All mutants were generated by site-directed mutagenesis with the QuikChange XL II site-directed mutagenesis kit (Agilent, Santa Clara, CA, USA), as previously described (33).
-
bioRxiv - Cell Biology 2023Quote: pLV-CMV-IRIS-PURO-c-Src-mScarlet plasmid was used to the generation of Y527F and Y527F/K295R mutants via QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, 200523) according to manufacturer’s protocol using the primers listed in Table 1.
-
bioRxiv - Physiology 2023Quote: ... Mutations were introduced by PCR-based site-directed mutagenesis method using the Quick Change II XL Site-Directed Mutagenesis Kit (Agilent Technologies, USA) and verified by sequencing (Supplementary Table 2).
-
bioRxiv - Cell Biology 2023Quote: ... according to the manufacturer’s instructions and quality checked using a Bioanalyser Eukaryote Total RNA Nano Series II chip628 (Agilent, Cat # 5067-1511). Libraries were prepared using the TruSeq Stranded mRNA Library Prep Kit (Illumina Cat # 20020594 ...
-
bioRxiv - Plant Biology 2023Quote: ... laevis oocyte assays were measured using an Agilent 1290 Infinity II LC system coupled to the 6545 Q-TOF MS (Agilent Technologies, USA). The LC separation was conducted on a Poroshell 120 EC-C18 analytical column (Agilent ...
-
bioRxiv - Plant Biology 2023Quote: ... were transferred to a glass insert and analysed with a 1290 Infinity II coupled to a 6560 Ion Mobility Q-TOF (Agilent Technologies, Inc.) as previously published (Drapal et al. ...
-
bioRxiv - Biophysics 2023Quote: ... the following HIV-1 IN mutants were prepared using the QuikChange II XL site directed mutagenesis kit (Agilent Technologies, Santa Clara, CA): E138K ...
-
bioRxiv - Biophysics 2022Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (33) ...
-
bioRxiv - Genetics 2023Quote: ... and Illumina adapters were added (second PCR) in a nested PCR manner using Agilent Herculase II Fusion DNA Polymerase Kit (Agilent, Cat # 600679). The PCR products were purified and sequenced using an Illumina NextSeq ...
-
bioRxiv - Genomics 2023Quote: ... The expression levels of selected genes were analyzed using SYBR Green chemistry (Brilliant II SYBR Green qPCR master mix (Agilent Technologies, USA) in the Stratagene mx3005P instrument (Agilent Technologies ...
-
bioRxiv - Systems Biology 2023Quote: The genomic integrated sgRNA libraries were amplified and indexed in two rounds of PCR using the Herculase II Fusion DNA Polymerase kit (Agilent Technologies 600679). The libraries were sequenced on an Illumina NextSeq with a custom primer oMCB1672 for read 1 and ≥21 cycles in read 1 ...
-
bioRxiv - Bioengineering 2023Quote: ... The clarified aqueous solution was filtered using a 0.22 µm filter and run on HPLC-RID (Agilent 1290 Infinity II/Agilent 1100) for glucose measurements ...
-
bioRxiv - Plant Biology 2023Quote: ... The phosphor- and galactosyl lipids in the lipid extracts were analysed in MS/MS mode with Infinity II 1290 UHPLC coupled to a 6550 iFunnel QTof (Agilent Technologies, Inc.), as previously described (Drapal et al. ...
-
bioRxiv - Physiology 2024Quote: cDNA encoding the mouse γ subunit was mutated to replace 140RKRR143 with 140QQQQ143 using the QuckChange II XL mutagenesis kit (Agilent Technologies). cDNAs encoding ENaC’s mouse α ...
-
bioRxiv - Neuroscience 2023Quote: ... the four 130 bp α-unit DNA fragments were amplified from each α-unit plasmid using the Herculase II Fusion DNA polymerase (Agilent) and oJS2581 and oJS2582 primers77 ...
-
bioRxiv - Genetics 2023Quote: ... 15 PCR-2 reactions were completed using Oligo 45 paired with Oligos 47-61 to amplify from YCp50-WT_PKR plasmid using Herculase II polymerase (Agilent Technologies Cat#600677) using cycling conditions for vector targets >10 kilo-base pairs ...
-
bioRxiv - Cell Biology 2023Quote: ... TMEM24(ΔBS + 5S → E)-eGFP was generated using site-directed mutagenesis to remove a portion of the C-terminus of TMEM24(5S → E)-eGFP including the first 3 β-strands of the β-sheet band 4.1 interacting domain (Quik-Change II XL; Agilent Technologies).TMEM24(5S → E)-eGFP which has been previously described (Sun et al. ...
-
bioRxiv - Immunology 2023Quote: ... Mutations were introduced into cDNAs using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent, Santa Clara, CA, USA; cat. no. 200521) to construct expression vectors for S variants with a single amino acid change ...
-
bioRxiv - Cell Biology 2023Quote: ... GYF motif mutant GIGYF1 (GIGYF1 GYF Mut; G502A, Y503A, F504A) plasmids were created using the QuikChange II Site-Directed mutagenesis kit (Agilent Technologies, 200523). The chimeric constructs were synthesized by GenScript (Piscataway ...
-
bioRxiv - Immunology 2024Quote: ... Quality and integrity of the RNA was checked on an Agilent Bioanalyzer 2100 total RNA Nano series II chip (Agilent, Amstelveen, Netherlands).
-
bioRxiv - Developmental Biology 2024Quote: ... The CrxE1/CAG::OC1 element was cloned using polymerase chain reaction (PCR) with the high fidelity Herculase II Fusion DNA Polymerase (Agilent cat# 600675) to add “Sal1” sites to the 261bp enhancer sequence ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral vector carrying mutant SPDEF (G277D) was generated using QuikChange II XL Site-Directed Mutagenesis Kit (cat# 200521, Agilent, Santa Clara, CA) with oligonucleotides (5’-tcctcaattttgaagatgtccttctccttgttgagcc-3’ and 5’-ggctcaacaaggagaaggacatcttcaaaattgagga-3’ obtained from IDT ...
-
bioRxiv - Developmental Biology 2024Quote: Individual and combination mutant versions of Homo sapiens CTNNB1 DNA constructs were generated using standard cloning techniques and the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, 200521), unless otherwise noted ...
-
bioRxiv - Neuroscience 2024Quote: ... Germany) mass spectrometry interfaced with an Agilent 1290 Infinity II Ultrahigh-Performance Liquid Chromatography (UHPLC) system (Agilent Technologies, Santa Clara, CA, USA) was used for analysis ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR probes were labelled with [α-32P]-dCTP (Hartmann Analytic #SRP-305) using the Prime-it II Random Primer Labelling Kit (Agilent, #EK0031) and purified on illustra Microspin G-50 columns (Cytiva #27533001 ...
-
bioRxiv - Biochemistry 2024Quote: ... which employed a 1290 Infinity II HPLC coupled to a 6550 QTOF-MS equipped with dual AJS electrospray ionisation source (Agilent, Cheadle, UK).12 Sample injection volume was 10 µL ...
-
bioRxiv - Biochemistry 2024Quote: ... Introduction of mutation (ATG to TAA) into the pcDNA3.1-HA-mGluR2-mCitrine construct was performed with the QuikChange II Site-Directed Mutagenesis Kit (Agilent, Catalog no. 200523) (for primer pairs ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-C1-tubbyCT R332H and pEGFP-C1-tubbyCT Y343F were generated using QuikChange II XL Site-Directed mutagenesis kit (Stratagene, Agilent Technologies, Waldbronn, Germany). pEGFP-C1-tubbyCT KR330/332AA was generated by mutagenesis PCR using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: The water samples were analysed for major anionic and cationic species with an ion-exchange chromatograph (IC, MIC-II, Metrohm Co., Switzerland) and an inductively-coupled-plasma mass spectrometer (ICP-MS, Agilent 7500 instrument, Agilent Technologies, Tokyo, Japan). Samples were filtered with polycarbonate membrane filters (0.45 μm ...
-
bioRxiv - Biochemistry 2019Quote: ... solvent A) and methanol:isopropanol (8:2 v/v, solvent B) was generated by an Infinity II 1290 UPLC (Agilent, Santa Clara, CA, USA) and with a constant flow rate of 600 μL min−1 (0 min ...
-
bioRxiv - Biochemistry 2019Quote: The eGFP-K17E construct for the mammalian expression of the SERF1a single-point mutant eGFP-K17E was generated by site-directed mutagenesis according to the QuickChange II mutagenesis kit manual (Agilent, Santa Clara, CA), using pEGFP/SERF1a (Tab ...
-
bioRxiv - Cell Biology 2021Quote: Both PCRs were performed in 100 µl with the 2 µl of the Herculase II Fusion DNA Polymerase from Agilent (ref. no. 600675) according the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... was then mutated to either R to mimic deacetylated c-Myc (K323R) or Q to mimic acetylated c-Myc (K323Q) using QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, 200522-5) against pPHAGE-EF1α-HA-Puro-c-Myc ...
-
bioRxiv - Plant Biology 2022Quote: ... Metabolites were then re-suspended in 100 μL distilled water and soluble sugars and sugar alcohols (fructose, glucose, sucrose, mannitol, sorbitol) were quantified by HPLC (Agilent 1260 Infinity II) using an 8 μm Hi-Plex Ca column (7.7 mm x 300 mm ...
-
bioRxiv - Microbiology 2022Quote: ... determination of As speciation and total As concentration were performed as described in [13] using an Agilent 8900 ICP-QQQ instrument coupled to an HPLC 1260 Infinity II (Agilent Technologies, CA, USA). Instrument settings in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... a variant mutated to change the tyrosines at positions 179 and 181 to phenylalanines was generated using a QuikChange II Site-Directed Mutagenesis Kit (#200523; Agilent, Santa Clara, CA) and the primer 5’ CATCCCCGCCTTCGCCTTCTATGTCTCACGTTGG 3′ ...
-
bioRxiv - Biochemistry 2022Quote: ... The pcDNA3.1 Flag-mRBPJ A284V CRr and the pcDNA3.1 Flag-mRBPJ F261A/A284V CRr were generated via site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies 200521-5) accordingly to manufacturer’s instructions with the oligos listed in Table S6 and using the pcDNA3.1 Flag-mRBPJ WT CRr and the pcDNA3.1 Flag-mRBPJ A284V CRr as templates ...
-
bioRxiv - Genomics 2021Quote: The concentration of the substrate and the phosphorylated product at each time point was determined by reversed-phase HPLC with UV detection at 214 nm (Agilent 1260 Infinity II). A 40 μL volume of the quenched reaction was injected onto a C18 column (ZORBAX 300SB-C18 ...
-
bioRxiv - Microbiology 2021Quote: ... from the pIdsBB expression system containing a C-terminal GFPmut2 fusion (Gibbs et al., 2008) using error-prone PCR with the GeneMorph II Random Mutagenesis Kit (Agilent, Santa Clara, CA) and ligated back into the same pIdsBB expression vector using the restriction enzymes SacI and BamHI ...
-
bioRxiv - Neuroscience 2021Quote: Conjugated cresols were analyzed via an Agilent 6470 triple quadrupole (QQQ) mass spectrometer with electrospray ionization (ESI) equipped with an Agilent 1290 Infinity II UHPLC (Agilent Inc, MA, USA). Conjugated cresols were separated with the Agilent C18 column (2.1 x 100 mm ...
-
bioRxiv - Systems Biology 2022Quote: DyTo was separated from the unreacted reagents and by-products by mass-directed preparative HPLC (infinity prep II, Agilent Series 1260, LC-MSD) using reversed-phase C18 column (VP10/125 5 μm ...
-
bioRxiv - Pathology 2019Quote: ... FLAG-tag was inserted between the CAAX motif (CVIQ) and stop codon in the full-length construct (Cat No: 200523, QuickChange II Site-Directed Mutagenesis kit, Agilent Technologies, Lexington, MA). For removal of the INF2 cleavage site ...
-
bioRxiv - Pathology 2020Quote: ... beads were collected for 2 min on a magnet and then resuspended in 25 µL PCR master mix containing PCR1 primers and Herculase-II (Agilent, Santa Clara CA). PCR cycling was as follows ...
-
bioRxiv - Plant Biology 2020Quote: ... Site-directed mutagenesis to generate the different H3.1 point mutant constructs was performed using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The ADA2b coding sequence was cloned into pETDuet-1 (Millipore ...
-
bioRxiv - Plant Biology 2019Quote: ... Mutations found in Bgh51 of Australian isolates were introduced into pYES-Bgh51wt through a QuickChange II site-directed mutagenesis kit (Stratagene, La Jolla, CA).
-
bioRxiv - Systems Biology 2019Quote: ... solution before being analysed on an Infinity II UHPLC coupled to an Agilent 6560 Ion Mobility Q-ToF LC-MS (Agilent, Santa Clara, USA), using a 20 min reverse-phase chromatographic separation with a C18 Acquity column (1.7 μm ...
-
bioRxiv - Biochemistry 2021Quote: ... The HPLC profile of tannic acid and gallic acid at both pH’s was obtained using an Infinity II HPLC system (Agilent Technologies, Santa Clara, CA) and an Agilent 5 prep-C18 column (50×21.2 mm ...
-
bioRxiv - Genetics 2020Quote: ... a natural NcoI restriction enzyme site located within intron 3 of the SPINK1 gene in the context of the previously constructed Mut expression vector was firstly eliminated by means of the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent, Les Ulis, France) according to the manufacturer’s instructions ...