Labshake search
Citations for Agilent :
1351 - 1400 of 1579 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... were generated by site directed mutagenesis on HA-NOD2 plasmid (a gift from Dana Philpott) using the QuickChange II Site-Directed Mutagenesis kit (Agilent Technologies) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Residues 811-825 in the Mtb RNAP β flap were deleted using Quick Change II XL site-directed mutagenesis kit (Agilent). Variants of the wild type sigAP and sigAP”ext-10” (harboring the T-17G-16T-15G-14 motif ...
-
bioRxiv - Neuroscience 2022Quote: ... and L454A (or MA4-WRLAAA) were generated using appropriate primers and the QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... the following primers were used to mutate the WIRS motif in the pcDNA3-DCCWT-HA construct using the Quikchange II site-directed mutagenesis kit (Agilent, #200523): CAACTCACCCACTCCGCGCCGCTGCTAATCCTTTGCTACC and GGTAGCAAAGGATTAGCAGCGGCGCGGAGTGGGTGAGTTG ...
-
bioRxiv - Neuroscience 2022Quote: ... and the p5xUAST-Fra-Myc constructs were subcloned into the smaller pBlueScript backbone and point mutations were introduced into the WIRS motif of the Fra coding sequences with the Quikchange II site-directed mutagenesis kit (Agilent, #200523) using the following primers ...
-
bioRxiv - Developmental Biology 2022Quote: The targeted analysis of THs was performed on an Agilent 6495c triple-quadrupole system with a hyphenated Agilent 1290 Infinity II ultra-high performance liquid chromatography (UHPLC) system (binary pump, degasser, and autosampler; Agilent Technologies) as previously described (39) ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were loaded on a Superdex 200 10/300 Increase GL Column (Cytiva) run by a 1260 Infinity II HPLC (Agilent Technologies) at 0.6 ml/min ...
-
bioRxiv - Bioengineering 2024Quote: ... was prepared by a controlled heparinase depolymerization method according to previous methods.26,45 The molecular weights of unfractionated heparin (UFH) and LMWH were determined by high-performance liquid chromatography (HPLC, 1260 Infinity II, Agilent, USA) with a GPC column (TSK Gel G2000SWXL ...
-
bioRxiv - Molecular Biology 2024Quote: ... Top-down LC-MS was carried out using an Agilent 1260 Infinity II high performance liquid chromatography (HPLC) system coupled to an Agilent 6230 ToF LC/MS (Agilent Technologies). Samples were injected onto an Agilent PLRP-S column (2.1 × 50 mm ...
-
bioRxiv - Immunology 2024Quote: ... we first inserted the SalI site at just downstream of the termination codon of the dsRed cDNA of pIRES2-dsRed-IRF418 using a QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies), and isolated the BglII-SalI fragment containing the mIRF4-IRES-dsRed DNA region from the mutated plasmid ...
-
bioRxiv - Biochemistry 2023Quote: ... was used as a template to generate deletion variants for expression in insect cells using the QuickChange II XL site-directed mutagenesis kit (Agilent Technologies). For bacterial expression of the ΔN790 variant ...
-
bioRxiv - Genetics 2023Quote: ... we inserted a wild-type histone array sequence containing the 5 replication-dependent histone genes into a pBluescript II KS+ vector (Agilent #212207) and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Genetics 2023Quote: ... Rev: TACTTCCAGCCAACCTCGTGAG) were used to perform Quantitative RT-PCR using the Brilliant II SYBR Green QRT-PCR Master Mix (Agilent # 600825) with the following program ...
-
bioRxiv - Genomics 2023Quote: ... Real time quantification of mRNA levels of the genes of interest was performed using Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies) per manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... Analysis was performed with an Agilent 6560 Ion Mobility Q-TOF coupled to an Agilent 1290 Infinity II (Agilent Technologies,Inc.). The samples were separated with an YMC-UltraHTPro C18 column (100 × 2 mm i.d ...
-
bioRxiv - Neuroscience 2023Quote: ... Comparison of samples taken at 0 and 24 h by HPLC-MS (1260 Affinity II, Agilent Technologies, Santa Clara, CA, USA) revealed no obvious decomposition or conversion to DAMGO ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The L834R mutation was introduced in EGFR using the QuikChange II Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Agilent Technologies, #200523). The plasmid used for the neural network training encoded for the extracellular and transmembrane domain (ECTM ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies) on an Mx3005p apparatus (Agilent Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... Comparison of samples taken at 0 and 24 h by HPLC-MS (1260 Affinity II, Agilent Technologies, Santa Clara, CA, USA) revealed no obvious decomposition or conversion to oxymorphone or naloxone ...
-
bioRxiv - Bioengineering 2023Quote: ... Specific site directed mutations on the S309 and CMAB0 antibody sequence was done using the Quick-change site directed mutagenesis kit II (Agilent technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... Flag-tagged wt and Ex19Del human EGFR constructs in the lentiviral VIRSP vector were generated by PCR with Herculase II Fusion DNA Polymerase (Agilent technologies) from EGFR WT (a gift from Matthew Meyerson ...
-
bioRxiv - Microbiology 2023Quote: ... Specific mutant constructs were subcloned from the mutants using appropriate restriction digestion sites or using the site-directed mutagenesis kit (Quick Change II Site directed mutagenesis kit, Agilent Technologies) following manufacturers protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Real time quantification of mRNA levels of the genes of interest was performed using Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies) per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mutagenesis of the HDE-like motifs and PAM sequence within donor plasmid for HDR was performed using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). pcDNA3.1(+)-ARRDC4-1 and pcDNA3.1(+)-ADCYAP1-2 expression vectors were constructed by cloning lnc-ARRDC4-1 and lnc-ADCYAP1-2 sequences to pcDNA3.1(+ ...
-
bioRxiv - Biophysics 2023Quote: ... Sample was loaded onto a Superdex 200 Increase 10/300 GL column (Cytiva) run by 1260 Infinity II HPLC (Agilent Technologies) at 0.6 ml/min ...
-
bioRxiv - Immunology 2023Quote: FFF experiments were performed with an Eclipse DualTec module (Wyatt Technology Corporation) running on an Agilent 1260 Infinity II platform (Agilent Technologies). Each sample (50 µg ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RT-qPCR was performed using the 1-Step Brilliant II SYBR Green quantitative RT-PCR master mix kit (Agilent Technologies) on a Bio-Rad C1000 Thermal Cycler CFX96 Real-Time System ...
-
bioRxiv - Biochemistry 2022Quote: The following materials were obtained from the cited sources and used in this study: Pfu Ultra II Fusion HS DNA Polymerase (Agilent Technologies); restriction enzymes and DNA ligation kit ver.2 (Takara Bio) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The peptides were purified by reverse-phase (RP)-HPLC using a preparative Agilent 1260 Infinity II Series HPLC-system (Agilent Technologies) with column 1 (Supplementary Table 13) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The freeze-dried products were identified via analytical HPLC-MS on an Agilent 1260 Infinity II Series HPLC-system (Agilent Technologies) using column 2 (Supplementary Table 13) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Ten μL was loaded onto a SHODEX ORPak CDBS-453 column and separated chromatographically using a 1290 Infinity II HPLC (Agilent Technologies) and the following gradient ...
-
bioRxiv - Genomics 2023Quote: ... the genomic DNA libraries were constructed with the NEBNext® Ultra™ II FS DNA Library Prep Kit (Agilent, CA, US). Thereafter ...
-
bioRxiv - Physiology 2023Quote: ... vortexed and centrifuged at 16,000 g for 3 min before analysis on a 1290 Infinity II ultrahigh performance liquid chromatography (UHPLC) system coupled to a 6546-quadrupole time-of-flight (Q-TOF) mass spectrometer (Agilent Technologies). Samples were separated on a Poroshell 120 HILIC-Z column (100 × 2.1 mm ...
-
bioRxiv - Cell Biology 2023Quote: The NR2A(M705V) or NR2A(A727T) mutation was introduced to the NR2A subunit using QuikChange II site-directed mutagenesis Kit (Agilent Genomics). DNA sequencing was used to confirm the cDNA sequences ...
-
bioRxiv - Microbiology 2023Quote: ... in vitro reaction mixes or cell extracts were analyzed on an Agilent 6495 triple quadrupole mass quadrupole mass spectrometer equipped with an ESI ion source and coupled to an Agilent 1290 Infinity II UHPLC (both Agilent Technologies). Chromatographic separation of ADP-heptose was achieved with an Acquity UPLC BEH Amide (1.7 µm ...
-
bioRxiv - Microbiology 2023Quote: ... DNA purity and concentration were assessed using an Agilent 2100 Bioanalyzer RNA Analysis chip (Eukaryote Total RNA Pico Series II) (Agilent Technologies). Samples from Exp ...
-
bioRxiv - Cancer Biology 2023Quote: ... An Agilent 1290 Infinity II LC and Agilent 6495 Triple Quadrupole MS system equipped with an Agilent Jet Stream ESI source (Agilent Technologies) was used for the analysis ...
-
bioRxiv - Genetics 2024Quote: ... GGC -> GGT) of dCas9 on pKR387 to remove an AscI recognition site using the QuikChange II site-directed mutagenesis kit (Agilent #200523). The resulting product was transformed into NEB 10-beta cells using a standard heat shock protocol and transformants were selected on LB agar plates with 100 μg/mL of carbenicillin ...
-
bioRxiv - Cell Biology 2023Quote: ... Twin-strep-Flag-HALO-DVL3 or pCS2+xDvl3 vector was performed using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) following a manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The desired PNUTS mutant in the RVXF motif (converting the RISW motif to RASA) was generated by oligonucleotide-mediated site-directed mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Biophysics 2023Quote: ... Sample was loaded onto a Superdex 200 Increase 10/300 GL column (Cytiva) run by 1260 Infinity II HPLC (Agilent Technologies) at 0.6 ml/min ...
-
bioRxiv - Biochemistry 2023Quote: ... The desired PP1 or PNUTS mutants were generated by oligonucleotide- mediated site-directed mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Top-down LC-MS was carried out using an Agilent 1260 Infinity II high performance liquid chromatography (HPLC) system coupled to an Agilent 6230 ToF LC/MS (Agilent Technologies). Samples were injected onto an Agilent PLRP-S column (2.1 × 50 mm ...
-
bioRxiv - Neuroscience 2023Quote: ... and 13C labeled TCA intermediates were measured on an Agilent 6546 QTOF mass spectrometer that was coupled with an Agilent 1290 Infinity II UHPLC system (Agilent Technologies). The column temperature was maintained at 15 °C and the autosampler was at 4 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... was carried out in a 25 μL reaction volume using the Brilliant II SYBR Green PCR Master Mix (Stratagene, Agilent technologies). Primer concentrations were set at 0.2 μM ...
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis of SARS-CoV-2 spike was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent 200522), using primers listed in Supplementary table S2 and according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: A UTR library of DNA templates was assembled by overlapping extension polymerase chain reaction (PCR) using Herculase II Fusion Enzyme (Agilent Technologies). Initially ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative real-time PCR was performed using a QuantStudio™ 5 Real-Time PCR System with Brilliant II low ROX Sybr Green (Agilent). Reactions were performed with at least 2 technical replicates and 3 biological replicates were performed for each experiment ...