Labshake search
Citations for Agilent :
1051 - 1100 of 1579 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... RpoB E310A and RpoB E310K were made by site-directed mutagenesis of the wild type constructs using the Quikchcange II XL kit (Agilent). B ...
-
bioRxiv - Cell Biology 2020Quote: ... The cytoplasmic and KASH domains of the mini-nesprin constructs were obtained from a previous publication.22 The mutant domain was made from this construct by site-directed mutagenesis (Quikchange II XL, Agilent). The DN-KASH construct was made by ligation after digestion by ClaI of a PCR product from the mini-nesprin construct ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Samples were analyzed using the 1290 Infinity II LC system coupled to a 6560 Ion Mobility Q-TOF (Agilent Technologies). Samples were analyzed with a Zorbax Eclipse Plus C18 50 × 4.6 mm column (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: HLA-restriction of antigen recognition was tested in anti-IFN-γ ELISpot using autologous DCs loaded with the relevant peptide or without peptide (negative control) and blocking antibodies against HLA class I and II (both Dako). DCs were incubated with peptides overnight and the next day anti-HLA mABs were added to ELISpot plates for 1 hour prior to the addition of expanded cells at a ratio of 1 DC to 50 expanded cells ...
-
bioRxiv - Microbiology 2021Quote: ... D614G and other SARS-CoV-2 Spike single mutations were generated using the QuickChange II XL site-directed mutagenesis protocol (Stratagene) and the pCG1-SARS-CoV-2-S plasmid kindly provided by Stefan Pöhlmann ...
-
bioRxiv - Developmental Biology 2021Quote: ... a BirA-2A-Cherry-SV40pA-FRT-Kan-FRT cassette was PCR-amplified using Herculase II fusion DNA polymerase (Agilent Technologies) and recombined into the first coding exon of tcf21 within the DKEYP 79F12 BAC clone as previously described (Weinberger ...
-
bioRxiv - Biochemistry 2020Quote: E.coli expression plasmids encoding GST-PEX14-NTD with amino acid substitutions were constructed via Site Directed Mutagenesis using QuikChange II (Stratagene). ß-tubulin (amino acids 388–444 ...
-
bioRxiv - Bioengineering 2021Quote: ... All PCR reactions for cloning and amplification of sequencing templates were performed using Herculase II Fusion DNA Polymerase (Agilent Technologies), and using GoTaq (Promega ...
-
bioRxiv - Bioengineering 2020Quote: The physico-chemical properties of fusion RBM-HFtn were analyzed by SEC-HPLC (Agilent 1260 Infinity II HPLC system, column Agilent AdvancedBio SEC 300Å 2.7 μm 7.8 × 300mm ...
-
bioRxiv - Developmental Biology 2021Quote: ... The catalytically dead mutants MMP28EA-pCS2 and MMP28EA-ΔSP/NLS-GFP-pCS2 were produced by point mutation of Glutamic acid226 to Alanine from MMP28wtpCS2 and Glutamic acid209 to Alanine from MMP28ΔSP/NLS-GFP-pCS2 using QuikChange II site-Directed Mutagenesis Kit (Agilent #200523) with the primers MMP28_E-A_fdw ...
-
bioRxiv - Biochemistry 2020Quote: ... The error-prone PCR (epPCR) library of the gene encoding qmLC/A was created with the GeneMorph II kit (Agilent) according to the manufacturer’s instructions ...
-
1H NMR chemical exchange techniques reveal local and global effects of oxidized cytosine derivativesbioRxiv - Biophysics 2021Quote: ... 50 Purification of the oligonucleotides was achieved with a HPLC system (Agilent 1260 Infinity II 400 bar pump and a Agilent 1260 Infinity II VWD detecting at 260 nm ...
-
bioRxiv - Microbiology 2021Quote: ... and the Spike from the B.1.429 lineage (S13I, W152C, L452R, D614G) were generated using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies). The amino acid deletions in the full-length SARS-CoV-2 Spike expressor were generated using the Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... - Kinetex EVO (5 μm, 100 Å)) using an HPLC system (Agilent, LC 1260 Infinity II, Agilent, Santa Clara, CA, USA). A two-step gradient was applied ...
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: ... The purified PCR products were subsequently used as megaprimers to generate the library of mutants in the plasmid pZE-ProQ-3×FLAG by following GeneMorph II EZClone Domain Mutagenesis Kit (Agilent) guidelines ...
-
bioRxiv - Cell Biology 2021Quote: PCR amplification of inserted sgRNAs from the genomic DNA was done with the Herculase II Fusion DNA Polymerase (Agilent Technologies) using the primers oMCB-1562 and oMCB-1563 ...
-
bioRxiv - Cell Biology 2021Quote: The CC and ORD domains of ORP5 or the TM domain of ORP8 were deleted using site-directed mutagenesis (Quickchange II-XL, Stratagene) to generate EGFP-ORP5ΔCC and EGFP-ORP5ΔORD or EGFP-ORP8ΔTM.
-
bioRxiv - Cell Biology 2021Quote: RNAi-resistant EGFP-ORP5A and EGFP-ORP5B were generated by introducing 4 silent point mutations in the region targeted by the 2 siRNA oligos (#10 and #11) by site-directed mutagenesis (Quickchange II-XL, Stratagene) and the following primers:
-
bioRxiv - Biochemistry 2020Quote: ... Site directed mutagenesis was performed on pRK5-HA-GβL using the Quik-Change II Site Directed mutagenesis kit (200523, Agilent Technologies) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... were created by point mutations on the pcDNA3.1-Cyb5r3 (WT) plasmid using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521). Mutagenesis primers were designed using Agilent’s online program ...
-
bioRxiv - Cell Biology 2021Quote: ... Point mutations and truncations were generated by site-directed mutagenesis using the QuikChange II Site-Directed mutagenesis kit (Agilent #200524) and verified by sequencing ...
-
bioRxiv - Plant Biology 2021Quote: ... The SEGS-2 ATG mutant (pNSB2110) was created in S2-1.5b (pNSB1869) using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and the primers ...
-
bioRxiv - Microbiology 2020Quote: ... was generated by introducing mutations in the 3’ splice site of the pPOLI-WSN-M plasmid using QuikChange II site-directed mutagenesis protocol (Agilent). pPolI-WSN-M-M2SMRtoAAA (Mut1) ...
-
bioRxiv - Microbiology 2020Quote: ... an optimal mutation rate (0.3–1 base/kb) for 1µg of template was adopted as recommended in GeneMorph II Random Mutagenesis kit (Agilent Technologies). The PCR products were then digested with EcoRI and HindIII and ligated into the pJF118EH vector using the same restriction enzymes ...
-
bioRxiv - Neuroscience 2020Quote: The single-cysteine mutations of GuD2 were generated by site-directed mutagenesis using the Quick Change II kit (Agilent technology) performed on pcDNA3-GluD220 ...
-
bioRxiv - Genomics 2021Quote: ... 4 μl of the purified product were amplified in multiple 100 μl reactions using Herculase II Fusion DNA Polymerase (Agilent) following the manufacturer’s specifications with 0.3 μM of the IS5/IS6 primers ...
-
bioRxiv - Microbiology 2021Quote: ... Site-directed mutagenesis was performed on plasmids expressing CV3-25 antibody heavy chain in order to introduce the GASDALIE mutations (G236A/S239D/A330L/I332E) using the QuickChange II XL site-directed mutagenesis protocol (Stratagene) (Ullah et al. ...
-
bioRxiv - Immunology 2020Quote: ... The S228P amino acid change in the anti-MuSK antibodies was achieved by converting AGC>CCC through side-directed mutagenesis based on the QuikChange II system (Agilent). To make the b12 antibody suitable as an exchange partner for cFAE ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding the single-mutation and the combination of mutations found in SARS-CoV-2 variants were generated by Quikchange II XL site-directed mutagenesis kit (Agilent). Recombinant Indiana vesicular stomatitis virus (VSV ...
-
bioRxiv - Systems Biology 2020Quote: ... 3.5 μl/well was then used as template for 2nd PCR in a 50 μl reaction together with 0.5 μl Herculase II fusion DNA polymerase (Agilent Technologies), 10 μl 5* Herculase II reaction buffer ...
-
bioRxiv - Microbiology 2020Quote: ... MinD and ClpX mutant proteins were constructed by site-directed mutagenesis of plasmids containing minD or clpX using the QuickChange II XL Site-directed mutagenesis kit (Agilent) and confirmed by sequencing prior to purification ...
-
bioRxiv - Microbiology 2020Quote: ... Point mutation of the active site residue Asn145 (Asn145Ala)61 was introduced using the QuikChange II site-directed mutagenesis kit (Agilent) to inactivate the Spd1 DNase (see Supplementary Table S2 for primer sequences) ...
-
bioRxiv - Microbiology 2022Quote: ... ORF6 mutations were introduced into the pLVX-StrepII-SARS-CoV-2-ORF6-IRES-Puro and pLVX-EF1α-SARS-CoV-2-ORF6-2xStrep-IRES-Puro plasmids using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions using SDM primers listed below ...
-
bioRxiv - Biochemistry 2022Quote: ... The preparation of variants was achieved through an error-prone PCR mutagenesis kit (GeneMorph II Random Mutagenesis Kit – Agilent Technologies), following the manufacturer’s instructions in order to insure high proportion of single-mutant variants ...
-
bioRxiv - Biochemistry 2022Quote: ... All site-directed mutagenesis was performed on this codon-optimized spike clone as the WT form using the QuikChange II Site-directed mutagenesis kit (Agilent), following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... a 6.0 kb XbaI fragment obtained by screening a BTx623-derived BAC library with a ZmRA1 probe was cloned into pBluescript II KS (Agilent) and the HindIII site in the polylinker was used for ligation into pSB11_BAR ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mutations were introduced in pENTR-SKOR1 following the QuikChange II XL Site-Directed Mutagenesis protocol (QuikChange; Agilent Technologies, Wilmington DE). Three silent mutations were introduced to create resistance to sh901 (SKOR1-shRes ...
-
bioRxiv - Cancer Biology 2022Quote: ... while the size and purity of the libraries were examined on a Bioanalyzer DNA 1000 series II chip (Agilent Technologies). The flow chart of the sequential steps involved in the TruSeq library preparation is given in Figure S2 ...
-
bioRxiv - Plant Biology 2021Quote: ... analyses were performed with a model QTRAP 6500 (ABSciex) mass spectrometer coupled to a liquid chromatography system (1290 Infinity II, Agilent). Analyses were performed in the positive mode ...
-
bioRxiv - Plant Biology 2021Quote: ... BsaI restriction sites were removed by site-directed mutagenesis using the “QuickChange II Kit” following the manufacturer’s instructions (Agilent Technologies). Plasmid DNA amplification was performed by heat-shock transformation into Escherichia coli DH5α cells (10min on ice ...
-
bioRxiv - Immunology 2021Quote: ... we changed three amino acids within the Fc region by using the QuikChange II site directed mutagenesis kits (Agilent, #200523), introducing M257Y ...
-
bioRxiv - Microbiology 2020Quote: ... A construct expressing the MBP-MogRQN→AA protein was created by site-directed mutagenesis of pMAL-p5x-mogR using the QuikChange II Site-Directed Mutagenesis Kit (Stratagene) with the same primers as for pHT304-Pxyl-MogRQN→AA ...
-
bioRxiv - Microbiology 2020Quote: ... The first reaction resulted in a plasmid containing 2,000 bp-long homologous arms (amplified from the genomic DNA of V. dahliae isolate Ls.17 using the Herculase II Fusion DNA polymerase; Agilent) flanking the neo cassette (conferring resistance to geneticin ...
-
bioRxiv - Microbiology 2021Quote: ... Substitution mutations in the IDR were constructed by site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). The pBad-Gfp-IDRFtsZ was constructed by cloning the coding sequence of Gfp-IDRFtsZinto the NheI and HindIII sites on the arabinose inducible vector ...
-
bioRxiv - Cell Biology 2021Quote: ... and were mutated by deleting 6-7 base pairs using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used for mutagenesis are listed in Supplementary Table S6 ...
-
bioRxiv - Cell Biology 2020Quote: ... All mutant constructs used in this study were generated from this construct either by a QuickChange II XL kit (Stratagene) or a Q5® Site-directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2021Quote: ... hEZH2-K381R-Fv: GGAGCTATGATGCTAGATTCCTTGACTCTAAACTCATACAC and hEZH2-K381R-Rv: GTGTATGAGTTTAGAGTCAAGGAATCTAGCATCATAGCTCC with site-directed mutagenesis kit (QuikChange II Site-directed mutagenesis kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Mutations of the two Walker-A motifs in human ABCF1 (K324M, K664M) were created by using Quikchange II Site Directed Mutagenesis Kit (Agilent). Human ABCF1 and yeast GCN20 domain fusion cDNAs were created by PCR-mediated ligation and cloned into modified pMtac-His6 vector ...
-
bioRxiv - Neuroscience 2020Quote: ... An AgeI site was inserted into exon 1 of Cacna1b by mutagenesis using a QuickChange II XL site-directed mutagenesis kit (Stratagene) with primers 1-For and 1-Rev ...
-
bioRxiv - Bioengineering 2020Quote: ... The post-lyophilization and reconstitution SEC was performed using an Agilent HPLC 1260 Infinity II LC System using an AdvanceBio SEC column (300 Å, 2.7 μm, Agilent). Fluorescence (excitation 285 nm ...