Labshake search
Citations for Agilent :
1401 - 1450 of 1579 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: The mass of massetolide E and massetolide F were analyzed using HR-ESI-MS recorded with Infinity II LC System (Agilent Technologies) coupled with a qTOF 6550 mass detector in positive ion mode ...
-
bioRxiv - Genetics 2024Quote: ... was used for all experiments with integrated Cas9 (Supplementary Table 3).25 Cas9D10A was generated by site-directed mutagenesis of pLS504 using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent #200521) using primers MK11 and MK12 ...
-
bioRxiv - Biophysics 2024Quote: ... and were then loaded on a Superdex 200 Increase 10/300 GL column (Cytiva) run by 1260 Infinity II HPLC (Agilent Technologies) at 0.6 ml/min ...
-
bioRxiv - Cell Biology 2024Quote: ... The S71A and S71E mutations were introduced into the pDONR221-gCDC42attb plasmid with the QuickChange II XL Site Directed Mutagenesis Kit (#200521, Agilent Technologies) with the following primers ...
-
bioRxiv - Cell Biology 2024Quote: ... The S71A mutation was introduced into the pMALc-MBP::CDC-42 plasmid with the QuickChange II XL Site directed mutagenesis kit (#200521, Agilent technologies) with the following primers ...
-
bioRxiv - Cell Biology 2024Quote: ... The INF2-ER[K792A] GFP construct was generated via site-directed mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). All constructs were sequenced completely across their coding region.
-
bioRxiv - Molecular Biology 2024Quote: ... RNA purity and concentration were assessed using an Agilent 2100 Bioanalyzer RNA Analysis chip (Eukaryote Total RNA Pico Series II) (Agilent Technologies). Quantitative real-time PCR (qPCR ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by measurement of quality and average cDNA length using the DNA 1000 Series II chip on a 2100 Bioanalyzer (Agilent Technologies). The multiplexed cDNA libraries were then pooled (two sets of 36 libraries ...
-
bioRxiv - Microbiology 2024Quote: ... Site-directed mutagenesis of the Trp252 residue in BoGH5A was performed using the QuikChange II Site Directed Mutagenesis (SDM) Kit (Agilent Technologies) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2024Quote: The mutant PDI-Ala256 protein was prepared from the full-length wild-type human PDI cDNA using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). For protein purification ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-C1-tubbyCT KR330/332AA was generated by mutagenesis PCR using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies, Santa Clara, US).
-
bioRxiv - Genetics 2021Quote: ... To reproduce the A-variant the following primers were used for SDM by site directed mutagenesis using QuickChange II site directed mutagenesis kit (Agilent Technologies, UK) using the following primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were co-transfected with 100ng pCAG-Lgr6 overexpression plasmid (pLgr6) or pBluescript II KS+ (pBKS) (Agilent Technologies, Santa Clara, CA, USA) as a control ...
-
bioRxiv - Developmental Biology 2021Quote: ... The mutated forms of the amplified sequence in which the potential m6A sites were replaced by cytidine (C) or guanine (G) were constructed using the QuikChange II XL Site-directed Mutagenesis Kit (Agilent Technologies, 200518). The fragments were separately inserted into the pCambia2300 vector ...
-
bioRxiv - Neuroscience 2020Quote: The point mutations and modifications in the linker sequence between CiVSD and FPs were done using the QuickCjhange II XL site-directed mutagenesis kit (Agilent Technologies, USA). The sequence verification of the novel constructs was done using Tag/dye-termination method (W ...
-
bioRxiv - Biochemistry 2019Quote: ... Samples were extracted 50:50 methanol:acetonitrile (ACN) and lipid extracts were analyzed by LC-MS (Bruker Impact II Q-TOF coupled to an Agilent 1200 LC stack). Positive ions were analyzed using XCMS software ...
-
bioRxiv - Neuroscience 2019Quote: ... pcDNA3.1-HA-SorCS1cβ Y1132A and GFP-tagged Rab7 T22N were generated by in vitro mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent, Cat #200522) from pcDNA4-SorCS1cβ-myc (kindly provided by Alan D ...
-
bioRxiv - Genomics 2019Quote: ... Quality and integrity of the isolated RNA were checked on an Agilent Bioanalyzer 2100 total RNA Nano series II chip (Agilent, Amstelveen, Netherlands), yielding RNA integrity numbers (RIN ...
-
bioRxiv - Biochemistry 2020Quote: ... The mutations to generate Asp276AlaSd and Tyr435HisSd were introduced by the QuikChange II Lightning Site-Directed Mutagenesis kit (Agilent, Santa Clara, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... which contains a 1.5 kb HindIII-SspI fragment containing the ura4+ gene between HindIII-EcoRV sites of pBluescript II KS+ (Agilent, Santa Clara, California).
-
bioRxiv - Bioengineering 2020Quote: ... LEU4 and Ll_ilvD were generated by error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). The CEN plasmids harboring wild-type ILV6 (pYZ127) ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using primers containing the T7 promoter sequence (on both forward and reverse primers) with PfuUltra II Fusion Hotstart DNA Polymerase (Agilent Technologies, #600672). PCR products with the expected size was separated using 1% agarose gel ...
-
bioRxiv - Cell Biology 2021Quote: ... The substitution S59D and S59A were introduced into the pLVX-IRES-FLAG-tagged HERPUD1 vector using the QuikChange II XL direct-mutagenesis kit (Stratagene, cat#200522) and the mutagenesis service of GenScript (Hong Kong ...
-
bioRxiv - Plant Biology 2020Quote: ... the HY5 36th Serine (AGC) was changed into Alanine (GCC) and Aspartic Acid (GAC) respectively using Quickchange II site-directed mutagenesis kit (Agilent, Catalog #200523) and cloned into pB7FWG vectors ...
-
bioRxiv - Developmental Biology 2021Quote: ... Deletion and mutation variants were generated using standard cloning techniques and the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, 200521).
-
bioRxiv - Cell Biology 2021Quote: ... pIRESneo2-EGFP-TOPBP1-ΔBRCT6 was generated by site directed mutagenesis of pIRESneo2-EGFP-TOPBP1-WT using QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies, 200522).
-
bioRxiv - Pathology 2022Quote: ... was performed at room temperature using an Agilent 1290 Infinity II UHPLC system coupled with an Agilent 6495 Triple Quad (Agilent Technologies, Germany) and an Eclipse Plus C18 1.8 µm 150 × 2.1 mm i.d ...
-
bioRxiv - Cell Biology 2022Quote: ... All other constructs were made by PCR amplification followed by standard restriction enzyme cloning or by site-directed mutagenesis kit (QuickChange II, Agilent Technologies, 200523). All oligonucleotides were obtained from Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... full-length cDNAs of the zebrafish banp gene were amplified with Polymerase Chain Reaction (PCR) and sub-cloned into pBluescript II SK(+) vectors (Stratagene/Agilent Technologies). cDNA fragments were amplified from mRNA with PCR using the primers for cenpt ...
-
bioRxiv - Cell Biology 2022Quote: ... and antisense primer (5’-GGA GAA AGG CAC CTG CCA GGC CTC AAC-3’) by site-directed mutation according to manufacturer’s protocol (QuikChange II XL Site-Directed Mutagenenesis Kit, 200521; Stratagene, LA Jolla, CA). The primers were designed to delete (in frame ...
-
bioRxiv - Developmental Biology 2022Quote: ... we introduced several point mutations variants in the Pax8 binding site using the QuikChange® II XL Site-Directed Mutagenesis Kit (Agilent Technologies) to generate the CNS1 mut-Luc vector ...
-
bioRxiv - Cell Biology 2022Quote: ... MD and mutated at AKAP12’s activation-responsive sites (S/T to A mutations) using the QuikChange II® site-directed mutagenesis Kit (Stratagene, CA) as we described previously (54) ...
-
bioRxiv - Microbiology 2021Quote: ... using a 1290 Infinity II UHPLC coupled to a 6545 QTOF mass spectrometer via Dual AJS ESI source (Agilent, Santa Clara, USA) and MassHunter data acquisition software (v.10.1) ...
-
bioRxiv - Biochemistry 2021Quote: ... HSF1-S326A and HSF1-T527A were carried out using a QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... The digestion and desalting (total time 3 min) were driven by 0.4% formic acid (FA) in water pumped by 1260 Infinity II Quaternary pump (Agilent Technologies, Waldbronn, Germany) at a flow rate of 100 μL·min−1 ...
-
bioRxiv - Pathology 2020Quote: ... Mutations required for domain excision and/or punctual changes within P1 nucleotidic sequence were introduced in the P1 open reading frame using the QuikChange® II XL Site-Directed mutagenesis kit (Agilent-Stratagene) and related primers (Appendix Table 1) ...
-
bioRxiv - Synthetic Biology 2021Quote: 384 well qPCR reaction plates for the multiplexed activation of endogenous genes (Figure 5 and 6) were set up using the Brilliant II SYBR master mix (Agilent cat #600828) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... All STIM1 variants were generated from the wild-type (WT) construct by site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, Massy, France). All resulting plasmids were checked by Sanger sequencing.
-
bioRxiv - Zoology 2020Quote: ... 5890 Series II gas chromatograph equipped with an HP-5 column (30 m×0.32 mm ID× 0.25 mm) (Agilent, Palo Alto, CA, USA). The oven temperature was held at 40 °C for 5 min ...
-
bioRxiv - Genetics 2019Quote: ... The site-directed mutagenesis was used to generate the constructs containing the other allele not amplified from initial cloning with the Quick Change II Site-Directed Mutagenesis Kit (Agilent Technology, USA). All the constructed plasmids were validated by sequencing and did not contain any other sequence variations ...
-
bioRxiv - Immunology 2021Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (Patil et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... was derived from pcDNA-V5-hWls (EVI/WLS-V5, Belenkaya et al, 2008) using the QuikChange II Site-Directed Mutagenesis Kits (200523, Agilent Technologies Inc.) according to the manufacturer’s instructions and the primers CGGAACATCAGTGGGAGGCAGTCCAGCCTGCCAGCTATGAGCAGAGTCCGGCGGC and GCCGCCGGACTCTGCTCATAGCTGGCAGGCTGGACTGCCTCCCACTGATGTTCCG ...
-
bioRxiv - Microbiology 2021Quote: ... Germany) equipped with an electrospray ionization source in line with an Agilent 1290 infinity II LC system (Agilent Technologies, CA, Unites States) was used ...
-
bioRxiv - Immunology 2021Quote: ... which were then injected into an Agilent 1290 Infinity II HPLC coupled to an Agilent 6495C iFunnel QQQ mass spectrometer (Agilent, California, USA). Separated analytes were eluted and introduced to the mass spectrometer ...
-
bioRxiv - Cell Biology 2020Quote: ... E706A/E1015A and E437A/E706A/E1015A=EallA) were obtained by site-directed mutagenesis of pCS2-3×HA-NFATc3 using the QuickChange® II XL kit (Agilent Technologies) using the indicated primers ...
-
bioRxiv - Biochemistry 2022Quote: ... The phPAI-1 library was generated by error prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) with primers that maintain the AscI and NotI restriction sites (SI Table 1) ...
-
bioRxiv - Neuroscience 2022Quote: Sample-specific sequencing libraries were prepared from the extracted genomic DNA of each harvested sample by amplifying and barcoding the lentivirally-integrated sgRNA spacer sequence using the Herculase II Fusion DNA Polymerase (Agilent Cat. 600679). Samples were pooled and sequenced on Illumina NextSeq 550 flow cells at 450–1000X read depth.
-
bioRxiv - Biochemistry 2024Quote: ... Cleavage was validated by SDS-PAGE and size exclusion chromatography on a Agilent 1260 Infinity II system using an Agilent AdvanceBio SEC 300 Å 2.7 μm 4.6x300 mm column (Agilent Technologies, PL1580-5301) using the manufacturer’s recommended conditions ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... Probes produced from PCR templates were radiolabelled with [α-32P]-dCTP (Hartmann Analytic, #SRP-305) using Prime-it II Random Primer Labelling kit (Agilent, #300385) and oligonucleotides used as a probe were radiolabelled with [γ-32P]-ATP (Hartmann analytic #SRP-501) ...
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNA-encoding genomic loci were amplified from up to 400 µg gDNA via PCR using a Herculase II Fusion Polymerase PCR kit (Agilent, Cat. #600677). Pooled reaction products from each treatment group were uniquely barcoded in a subsequent PCR reaction followed by electrophoresis on 2% TBE-agarose gel at 120 V ...