Labshake search
Citations for Agilent :
1301 - 1350 of 1579 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... All point mutations generated using the ankyrin-B-GFP cDNA construct were made using site-directed mutagenesis (QuickChange II XL, Agilent Technologies) and confirmed by DNA sequencing through Eurofins Genomics (Louisville ...
-
bioRxiv - Immunology 2022Quote: ... Label tracing was carried out using an Agilent 1290 Infinity II UHPLC inline with a Bruker impact II QTOF-MS operated in full scan (MS1) mode or gas chromatography mass spectrometry (Agilent 5977). Data processing including correction for natural isotope abundance was performed by an in-house R script ...
-
bioRxiv - Cancer Biology 2022Quote: ... K277Q or K277R directed mutagenesis was performed on this vector using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521), following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: Site-directed mutagenesis was carried out using a QuikChange II Site-Directed Mutagenesis Kit (Stratagene, Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... The exact point mutations for each of the three Hsf1 missense mutations were engineered into the cDNA of ZmHK1 in the plasmid P415-CYC1-ZmHK1 plasmid with the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) using the manufacturer’s specifications.
-
bioRxiv - Pathology 2019Quote: ... Pathogenic mutations and variations in the INF2 sequence were introduced by a PCR-based mutagenesis (Cat No: 200523, QuickChange II Site-Directed Mutagenesis kit, Agilent Technologies). To achieve stable expression of fragments in human podocytes ...
-
bioRxiv - Pathology 2020Quote: ... Mutations required for domain excision and/or punctual changes within P1 nucleotidic sequence were introduced in the P1 open reading frame using the QuikChange® II XL Site-Directed mutagenesis kit (Agilent-Stratagene) and related primers (Appendix Table 1) ...
-
bioRxiv - Biophysics 2019Quote: ... The fusion constructs were generated by deletion of amino acids from the 5-HT3A-ICD using appropriate partially overlapping primers with the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing (GENEWIZ ...
-
bioRxiv - Microbiology 2019Quote: ... pT7-NSP5/S67A carrying a mutation in the nucleotide T220G in the gs11 and pT7-NSP5/Tyr18Stop harbouring a nucleotide substitution T75G were generated by QuikChange II Site-Directed Mutagenesis (Agilent Technologies). pT7-NSP5/ΔT was generated from pT7-NSP5-SA11 by deleting the last 18 C-terminal amino acids (FALRMRMKQVAMQLIEDL ...
-
bioRxiv - Microbiology 2019Quote: ... 39) with primers WNTP0548 (GAGTTATTGGGGGCTTGAAGT) and WNTP0549 (AATCCTTTTTCGATGTTGATAATTAAGTCG) and subjected to random mutagenesis using GeneMorph II EZClone Mutagenesis kit (Agilent Technologies) per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... p10UAST-Robo1-MYC and the p5UAST-HA-Robo1 constructs were subcloned into the smaller pBlueScript backbone and point mutations were introduced into the WIRS motif of the Robo coding sequences with the Quikchange II site-directed mutagenesis kit (Agilent, #200523) using the following primers ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The error-prone library of the initial hit of the ACE2 helix scaffolded design was constructed by error-prone PCR with a GeneMorph II Random Mutagenesis Kit (Agilent Technologies) with manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human M280L mutation in FOXR1 was generated by introducing a point mutation at residue 280 (methionine to leucine) using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) in the pSport6 human FOXR1 plasmid with the following forward 5’-CCAACAGTGCTTGAGCCAGCCAG-3’ and reverse 5’-ATACTTTCTAGCCGAGTGGAAG-3’ primers and verified by nucleotide sequencing ...
-
bioRxiv - Biochemistry 2020Quote: The HNL1-esterase variant was created by three single-amino-acid substitutions in the gene for HNL1 added stepwise (Thr11Gly, Lys236Gly, Glu79His) in the order listed using the QuickChange II method (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: The removal of the C327-T331 segment from the CM domain of PniDAH7PS was performed using a QuikChange® II Site-Directed Mutagenesis Kit (Stratagene). The pET28a-PniDAH7PS plasmid was used as the template ...
-
bioRxiv - Molecular Biology 2019Quote: ... We generated E-box point mutations (CANNTG ➔ CANNTA) with the QuikChange II site-directed mutagenesis kit (Agilent, 200523, Santa Clara, CA) per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Site-directed PCR mutagenesis was then carried out to mutate the codon corresponding to valine 189 (GTC into GAC) using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). Overlapping PCR was used to add a C-terminus 3Flag epitope and a marker conferring resistance to Nourseothricin and the resulting PCR fragment was transformed into fission yeast using routine protocols ...
-
bioRxiv - Microbiology 2019Quote: ... encoding the I78A variant of alt-SDHC was obtained by site-directed mutagenesis using QuikChange® II Site Directed Mutagenesis kit (Stratagene) following provider’s instructions and oligos listed in S3 dataset ...
-
bioRxiv - Cell Biology 2021Quote: ... or of the phospho FFAT motif (Y768A, T770A, T770D/P771A) were generated using site-directed mutagenesis (QuikChange II XL; Agilent technologies) of EGFP-Miro1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The mutant eGFP-CCR5-L196K (substitution of L196 with a lysine) was generated by site-directed mutagenesis using the QuickChange II Mutageneis kit (Agilent Technologies) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... HA-USP29 siRNA-resistant and the catalytically inactive USP29C294S were generated using the QuikChange® II XL Site-Directed Mutagenesis Kit (Stratagene) and the oligos reported in Table 1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2.7 μm) and fractioned using an Agilent 1260 Infinity II High Performance Liquid Chromatography (HPLC) system (Agilent, Wil-mington, DE, USA). Mobile phases were prepared as follows ...
-
bioRxiv - Biochemistry 2021Quote: ... amino acid substitutions were introduced using a QuikChange II XL site directed mutagenesis kit (200521) purchased from Agilent (Santa Clara, CA). After transformation into BL21-Gold (DE3 ...
-
bioRxiv - Cell Biology 2019Quote: ... and indels were determined by amplification of the sgRNA target site by polymerase chain reaction using Herculase II Fusion DNA Polymerase (Agilent biotechnologies) and Sanger sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... and integrated lentiviral sgRNA sequences were amplified by a two-step PCR reaction (20 cycles and 14 cycles, respectively) as previously described (32, 41) using a Herculase II Fusion DNA Polymerase kit (Agilent biotechnologies). DNA was purified after each of the PCR reactions using a QIAquick PCR purification kit (Qiagen) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was measured using an XBridge Amide 3.5 μm, 4.6 × 150 mm column (Waters, Milford, MA) on a 1220 Infinity II HPLC (Agilent, Santa Clara, CA). The mobile phase was water/acetonitrile 20:80 to 60:40 at a flow rate of 1.0 mL/min for 6 min ...
-
bioRxiv - Biophysics 2021Quote: Mutations were introduced into the human CFTR(E1371S)/pGEMHE and CFTR(D1370N)/pGEMHE sequences using the QuikChange II XL Kit (Agilent Technologies) and confirmed by automated sequencing (LGC Genomics GmbH) ...
-
bioRxiv - Genetics 2021Quote: ... All PCR amplification steps were performed using the high-fidelity Herculase II Fusion DNA Polymerase (Agilent, Santa Clara, CA, United States), and assembly of the recombinant vector was performed with the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... Enzymatically-dead zDHHC3 mutant transgenic mice overexpressing zDHHC3DHHS in cardiomyocytes were generated by site-directed mutagenesis of the α-MHC-Zdhhc3 promoter-transgene construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to encode a mutation of Cys-157 in mouse zDHHC3 protein to Ser ...
-
bioRxiv - Molecular Biology 2021Quote: The hydrophobic residues Phe5 and Leu7 in LepB TMH1 were replaced with arginine (R) in construct N = 55 by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden). Multiple alanine substitutions (underlined ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single alanine substitutions of Cys171 and Cys177 in construct N = 223 were made by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden).
-
bioRxiv - Immunology 2020Quote: ... The primary antibodies used for immunohistochemistry were: antihuman HLA-DR (referred to from here as MHC-II) (Dako M0746; 1:40); anti-human CD3 (Dako A0452 ...
-
bioRxiv - Neuroscience 2020Quote: ... were generated with site-directed mutagenesis using custom-designed primers (Eurofins Genomics) and PfuUltra II Fusion HS DNA Polymerase (Agilent Technologies). Truncated NALCN ...
-
bioRxiv - Biophysics 2020Quote: ... the chromosomal locus comprising the open reading frame slr1645 (Psb27) was amplified by PCR (Table S2) using Herculase II Phusion DNA polymerase (Agilent USA) and integrated at a neutral site within the Synechocystis genome between ORFs slr1169 and slr1285 (Fig ...
-
bioRxiv - Genetics 2020Quote: ... and checked for quality on an Agilent 2100 Bioanalyzer with a DNA 1000 Series II chip (Agilent Technologies, Santa Clara, CA). ...
-
bioRxiv - Cell Biology 2022Quote: ... ASNA-1A63V::GFP was generated by mutagenesis of pVB222GK (Kao et al., 2007) to introduce the A63V change using the QuickChange II Kit (Agilent Technologies). The resulting plasmid (pGK200 ...
-
bioRxiv - Microbiology 2022Quote: ... ΔNef ANCH3 (HIV-1 ANCH3 IND116A) was obtained by insertional mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent #200522), for integrase (IN ...
-
bioRxiv - Biochemistry 2022Quote: ... Point mutations (I91F and K176E) were introduced using the QuickChange II XL Site-Directed Mutagenesis Kit (SI Table 1; Agilent Technologies). The full-length sequence of the PAI-1 constructs was confirmed by Sanger sequencing (SI Table 1) ...
-
bioRxiv - Genetics 2022Quote: To introduce the T1035S or R1147W mutations we used the QuikChange II XL Multi Site-Directed Mutagenesis kit (Agilent Technologies, #200521). The primers for the single mutagenesis experiments were designed by QuikChange software (Stratagene ...
-
bioRxiv - Biophysics 2022Quote: ... PPARγ2 mutants were generated by nucleotide substitution using the QuikChange II XL Site Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... All the mutants used in these cellular assays were generated by using QuikChange II-E Site-Directed Mutagenesis Kit (#200555, Agilent Technologies).
-
bioRxiv - Cell Biology 2022Quote: ... vortexed and centrifuged at 16,000 g for 3 min before analysis on a 1290 Infinity II ultrahigh performance liquid chromatography (UHPLC) system coupled to a 6546-quadrupole time-of-flight (Q-TOF) mass spectrometer (Agilent Technologies). Samples were separated on a Poroshell 120 HILIC-Z column (100 × 2.1 mm ...
-
bioRxiv - Cell Biology 2022Quote: ... c-Src cloned in pBluescript SK+ vector through BamHI and XbaI sites was mutated using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) with the forward primer (5’-CCACTTTCGTGGCTCTCGAGGACTACGAGTCCCGGACTG-3’ ...
-
bioRxiv - Cancer Biology 2022Quote: ... dried metabolites were resuspended in 50 μL of a 1:1 DMSO to water solution and analyzed by LC-MS using a 1290 Infinity II liquid chromatography (Agilent Technologies) with a thermal autosampler set at 4°C ...
-
bioRxiv - Genetics 2022Quote: ... 2014) bearing FRQ point mutations to restriction-digested pCB05 in place of the QuickChange II® Site-directed Mutagenesis Kit (Stratagene). Four primer sets were used as flanks to facilitate homologous recombination in a yeast strain (FY834 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Deletion of putative TF binding sites from those enhancers were performed using QuickChange II XL site-directed mutagenesis kit (Agilent Technologies). All constructs were confirmed by Sanger Sequencing (Quintara Biosciences) ...
-
bioRxiv - Microbiology 2022Quote: ... containing 1 µM sulfadimethoxine as an internal standard before analyzing 15 µL on a 1290 Infinity II UHPLC system (Agilent Technologies) coupled to an ImpactII ultra-high resolution Qq-TOF mass spectrometer (Bruker Daltonics ...
-
bioRxiv - Plant Biology 2022Quote: ... The resulting aqueous elution was analyzed in positive mode using an Agilent 1200 Infinity II UPLC separation system coupled to an Agilent 6550 iFunnel qTOF mass spectrometer (Agilent, USA). Compounds were separated by infecting 5 μL of sample onto a Zorbax Eclipse Plus C8 RRHD UPLC column (2.1×100 mm ...
-
bioRxiv - Microbiology 2023Quote: ... BST2 M1A) and ATG5 (ATG5-K130R) were made by PCR mutagenesis using the QuikChange II XL site directed mutagenesis kit (Stratagene, France). The cDNA encoded ATG5-K130R was cloned in frame with GFP tag into the pEGFP-C1 vector ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 200 μL reactions using Herculase II DNA polymerase were conducted according to the manufacturer’s protocols (Agilent, Santa Clara, CA, USA; 600675). PCR reactions were purified and digested with 10U of lambda exonuclease (New England Biolabs ...