Labshake search
Citations for Agilent :
6301 - 6350 of 6604 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... The mitochondrial function of macrophages and amastigotes was analyzed by the Agilent Seahorse XF Cell Mito Stress Test Kit (Agilent, 103015-100). The glycolytic function of infected macrophage was analyzed by the Agilent Seahorse XF Glycolytic Stress Test Kit (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral vector carrying mutant SPDEF (G277D) was generated using QuikChange II XL Site-Directed Mutagenesis Kit (cat# 200521, Agilent, Santa Clara, CA) with oligonucleotides (5’-tcctcaattttgaagatgtccttctccttgttgagcc-3’ and 5’-ggctcaacaaggagaaggacatcttcaaaattgagga-3’ obtained from IDT ...
-
bioRxiv - Plant Biology 2024Quote: ... where the RNA Integrity Number (RIN) was assessed using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent, Santa Clara, USA). Strand-specific mRNA libraries were prepared with poly-A enrichment and sequenced on the NovaSeq 6000 platform (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... The quality of total RNA was assessed with an Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano Kit (Agilent Technologies, Boeblingen, Germany). The median RIN of the investigated cohort was 8.1 (see Figure S23).
-
bioRxiv - Cell Biology 2024Quote: ... We mutated the Serine 69 to Alanine (69A) or aspartic acid (69D) using the QuickChange II Site-directed Mutagenesis kit (Agilent Technologies, #200523). The primer for mutating S69-A was ...
-
bioRxiv - Genomics 2024Quote: ... RNA integrity number (RIN) was measured using Agilent Bioanalyzer RNA 6000 nano kit (Cat# 5067-1511, Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Genomics 2024Quote: ... the whole exome sequencing libraries were prepared with the Agilent SureSelect Paired-End Version 2.0 Human Exome Kit (Agilent, Santa Clara, CA). Sequencing of post-enrichment shotgun libraries was performed on an Illumina Genome Analyzer II following manufacturer’s protocol for 50 bp paired-end reads ...
-
bioRxiv - Genomics 2024Quote: ... The quality of total RNA was assessed with an Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano Kit (Agilent Technologies, Boeblingen, Germany). Next ...
-
bioRxiv - Immunology 2024Quote: Mutagenesis of Env expressing plasmids for pseudovirus production and for soluble Env production was performed using the QuickChange II XL kit (Agilent Technologies, USA) according to the manufacturer’s instructions using 10 ng of plasmid template encoding the respective Env ...
-
bioRxiv - Genomics 2024Quote: ... to generate fragment sizes of ∼350bp as evaluated by an Agilent 2100 Bioanalyzer using the High Sensitivity DNA kit (Agilent, Santa Clara). We adjusted the volume of sheared samples with nuclease-free water up to 50µl ...
-
bioRxiv - Genomics 2024Quote: ... The concentration and size distribution of the sequencing libraries were quantified using the Agilent D1000 High Sensitivity Screentape Kit (Agilent 5067-5584) on an Agilent TapeStation 2200 system ...
-
bioRxiv - Genomics 2024Quote: ... The concentration and size distribution of the sequencing libraries were quantified using the Agilent D1000 High Sensitivity Screentape Kit (Agilent 5067-5584) on an Agilent TapeStation 2200 system.
-
bioRxiv - Cancer Biology 2024Quote: ... and two-point mutations (L858R and C797S) were introduced in the intracellular kinase domain using the QuickChange site-directed mutagenesis kit (Agilent, Santa Clara). Primer sequences are provided in Suppl ...
-
bioRxiv - Cell Biology 2024Quote: ... and F272fs287X (c.813del) in the GABAAR α1 subunit were constructed using a QuikChange II site-directed mutagenesis Kit (Agilent Genomics, #200523), and the cDNA sequences were confirmed by DNA sequencing.
-
bioRxiv - Cancer Biology 2024Quote: ... The resulting WGBS libraries were evaluated on a 2100 Bioanalyzer using the Agilent High-Sensitivity DNA Kit (Agilent Technologies, cat. #5067-4626) and quantified via qPCR using the KAPA Library Quantification Kit (KAPA Biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... The MSCV PRDM16 vector was used as a template to produce the mutant Prdm16 by changing the GACCTG sequence to GCAAGC using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies #200521) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA concentration was quantified using Nanodrop and the RNA Integrity Number (RIN) was assessed using the Agilent RNA 6000 Pico Kit (Agilent, 5067-1513) on Agilent 2100 Bioanalyzer (Agilent) ...
-
bioRxiv - Cell Biology 2024Quote: ... Fragmentation of chromatin to an average size of 150-500bp was checked on Agilent 2100 Bioanalyzer using High Sensitivity DNA Kit (Agilent, 5067-4626). To reduce the SDS ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μL of SST1-F/R PCR product was cloned into pSC-A-amp/kan vector using Strataclone™ PCR Cloning Kit (Agilent, Cat.#240205) following manufacturer’s instructions and transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Rapsyn-FLAG and rapsyn-Venus1 E162K mutants were generated by site-directed mutagenesis using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-C1-tubbyCT R332H and pEGFP-C1-tubbyCT Y343F were generated using QuikChange II XL Site-Directed mutagenesis kit (Stratagene, Agilent Technologies, Waldbronn, Germany). pEGFP-C1-tubbyCT KR330/332AA was generated by mutagenesis PCR using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... The quality and quantity of extracted RNA were measured by on-chip electrophoresis utilizing the Agilent RNA 6000 Nano Kit and Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA). Samples exhibited 1.9≤A260/A280◻≤◻2.2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Biotin-labeled amplified RNA (aRNA) size distribution and quantity was analyzed with the Agilent 2100 Bioanalyser using the RNA 6000 Nano LabChip kit (Agilent Technologies, Boeblingen, Germany). Samples with lower size compressed RNA products were discarded ...
-
bioRxiv - Molecular Biology 2020Quote: ... All site-directed mutagenesis reactions were performed by following the instructions in the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene, CA). Primers used for PCR and site-directed mutagenesis reactions are indicated in Supplemental Table S2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The integrity of the synthesized RNAs was assessed using Agilent RNA 6000 Nano Kit with Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA), these newly synthesized sgRNA constructs will be referred to as RP Loop sgRNA (RP-loop sgRNA ...
-
Single-cell analysis of skeletal muscle macrophages reveals age-associated functional subpopulationsbioRxiv - Cell Biology 2022Quote: ... cDNAs were then used for library preparation and the quality of the final libraries assessed on the Agilent Bioanalyzer with DNA 1000 kit (Agilent, Cat# 5067-1504). The libraries were sequenced with Illumina Nova-sequencer with a depth of 300-400 million reads per sample ...
-
bioRxiv - Genomics 2020Quote: ... The quality and concentration of the extracted RNA was measured with the Agilent RNA 6000 nano kit (Cat-No: 5067-1511, Agilent, Santa Clara, CA) on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Cell Biology 2020Quote: pSecTagNC + ΔEGF_mN1 W1758A and pSecTagNC + ΔEGF_mN1 R1994A: these plasmids were generated by PCR-based mutagenesis using the QuikChange Lightning Multi Site-Directed mutagenesis kit (Stratagene, Santa Clara, USA) using pSecTagNC + ΔEGF_mN1 as a template and primers ...
-
bioRxiv - Cell Biology 2020Quote: pcDNA3 + mNICD R1994A: this plasmid was generated by PCR-based mutagenesis using the QuikChange Lightning Multi Site-Directed mutagenesis kit (Stratagene, Santa Clara, USA) using pcDNA3 + mNICD as a template and the primer A2026VmutF.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The quality of RNA samples was analyzed using the RNA 6000 Pico Kit running on the 2100 BioAnalyzer (Agilent Santa Clara, California, US). Total RNA was diluted in a final volume of 50 μL for a total input of 1 μg ...
-
bioRxiv - Genomics 2020Quote: ... Chromium Genome Reagents Kit Version 2 User Guide) and size and concentration determined using an Agilent 2100 Bioanalyzer DNA 1000 chip (Agilent Technologies, CA, USA). Libraries were then sequenced on an Illumina NovaSeq 6000 System following the manufacturer’s protocols (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... 100 nucleotides) was verified by fluorescent capillary electrophoresis using an Agilent 2100 Bioanalyzer (Agilent RNA 6000 pico kit, Agilent, Santa Clara, CA, USA).
-
bioRxiv - Immunology 2021Quote: ... The concentration and quality of the RNA was determined by an Agilent 2100 Bioanalyzer with the Agilent RNA 6000 Pico Kit (Agilent Technologies, #5067-1513). The oligonucleotides used for the NGS were tabulated (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was eluted into 10 μL of nuclease free water and analyzed on Agilent 2100 Bioanalyzer using the RNA 6000 Pico kit (Agilent, catalog #5067-1513). For protein analysis ...
-
bioRxiv - Bioengineering 2020Quote: ... ENVs were collected 3 days after electroporation and analyzed for miR-101-3p content by RT-PCR using the qScript microRNA cDNA Synthesis Kit (Quanta Biosciences, Beverly, MA) and SYBR Mastermix (Quanta Biosciences) on a Stratagene Mx 3000 P (Stratagene, San Diego, CA). The primer for miR-101-3p was (TACAGTACTGTGATAACTGAA) ...
-
bioRxiv - Cancer Biology 2020Quote: Extracellular acidification rate (ECAR) was analyzed on a XF96 Extracellular Flux Analyzer using XF Glycolysis Stress Test Kit (Agilent Technology, Santa Clara, CA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... We performed exome sequencing in the child with neonatal diabetes and his consanguineous parents using the Agilent SureSelect Human All Exon Kit (Agilent SureSelect v4, 50Mb). We analyzed the data with our established pipeline in the institute (Kuhnen ...
-
bioRxiv - Plant Biology 2020Quote: RNA sample concentration and purity was assessed using the DeNovix DS-11 spectrophotometer (DeNovix Inc., Wilmington, DE, USA) and concentration and integrity were assessed using the Agilent RNA 6000 Nano Kit (Agilent Technologies, Waldbronn, Germany) in conjunction with the Agilent 2100 Bioanalyzer software according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Following visualization and an estimation of the concentration using the High Sensitivity D1000 DNA Kit on the Agilent 2200 TapeStation system (Agilent Technologies, CA, USA), the samples were pooled according to concentration ...
-
bioRxiv - Genomics 2021Quote: ... Library quality control was performed using the 2100 Bioanalyzer System with the Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA). The libraries were individually quantified via qPCR using a KAPA Library Quantification Kits (Kapa Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... The average sample fragment length and purity was determined using Agilent High Sensitivity DNA kit and the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA). After passing quality control measures ...
-
bioRxiv - Neuroscience 2020Quote: ... One microliter of sample was used to determine the concentration (Qubit 3.0 fluorometer) and integrity (Agilent 2100 Bioanalyzer, Agilent High Sensitivity DNA Kit). RNA sequencing was performed using the PE100 strategy (HiSeq 2500 ...
-
bioRxiv - Microbiology 2021Quote: RNA quality was evaluated spec-trometrically by Trinean Xpose (Gentbrugge, Belgium) and by fragment size distribution on an Agilent 2100 Bioanalyzer with the RNA Nano 6000 kit (Agilent Technologies, Böblingen, Germany). Electropherograms for the endpoint RNAseq samples were exported as XML files for further analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... The size distribution and concentration of s-mEV miRNA was further assessed using a 2100 Agilent Bioanalyzer with an Agilent Small RNA Kit (Agilent Technologies, CA, USA), according to the manufacturers’ instruction.
-
bioRxiv - Microbiology 2021Quote: ... samples were run on an Agilent Bioanalyzer 2100 using an Agilent High Sensitivity DNA kit as recommended by the manufacturer (Agilent Technologies, Waldbronn, Germany). Concentrations of the libraries were determined using the Qubit® dsDNA HS Assay Kit as recommended by the manufacturer (Life Technologies GmbH ...
-
bioRxiv - Cell Biology 2020Quote: ... and Nup133-mEGFP(-7) were cloned from the repair template plasmids constructed above via the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). For each CRISPR cell line ...
-
bioRxiv - Biophysics 2021Quote: ... were created using a 1.3mer HBV plasmid (gifted by Dr. Haitao Guo)(59) and site-directed mutagenesis kit (QuikChangeII, Agilent Technologies, Santa Clara, CA) with corresponding primers (University of Calgary DNA Synthesis Lab ...
-
bioRxiv - Cell Biology 2021Quote: ... was then mutated to either R to mimic deacetylated c-Myc (K323R) or Q to mimic acetylated c-Myc (K323Q) using QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, 200522-5) against pPHAGE-EF1α-HA-Puro-c-Myc ...
-
bioRxiv - Neuroscience 2022Quote: ... The quality and profile of individual libraries have been quantified and visualized using Qubit™ and the Agilent Bioanalyzer dsDNA High Sensibility Kit (Agilent Technologies, USA) respectively ...
-
bioRxiv - Microbiology 2021Quote: ... This clone was then used to generate single or multiple mutations in the RBD of S gene with site-directed mutagenesis kit (Agilent, Santa Clara, CA) using primers listed in the supplemental Table 2 and designated as pAbVec-SARS2-S (mutant) ...