Labshake search
Citations for Agilent :
6201 - 6250 of 6604 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Site-directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Microbiology 2022Quote: ... DNA and RNA quality was checked with the Agilent 2100 Bioanalyzer and the High sensitivity DNA/RNA kit (Agilent, Santa Clara, USA).
-
bioRxiv - Systems Biology 2022Quote: ... The library quality was assessed by an Agilent 2000 Bioanalyzer with Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA) for fragment sizes of 500–1000 bp ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA quantity and purity were analyzed using an RNA 6000 Nano LabChip Kit and a Bioanalyzer 2100 (Agilent, Santa Clara, CA). High quality RNA samples with RIN number > 7 were used to construct the sequencing library ...
-
bioRxiv - Genetics 2022Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Cancer Biology 2022Quote: ... slices were then incubated with anti-cleaved caspase 3 antibody or anti-Ki67 antibody (Cell Signalling) and further processed with secondary antibody (LSAB2 horseradish peroxidase kit; Dako, Copenhagen, Denmark).
-
bioRxiv - Cell Biology 2022Quote: ... Full-length GFP-LRRK2 harboring an R361A mutation was generated by site-directed mutagenesis of pcDNA5 FRT/TO GFP-LRRK2 (DU13363) using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies, 210518) according to the manufacturer’s protocol and the following mutagenic primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... The total RNA quantity and purity were analysis of Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (5067-1511, Agilent, CA, U.S.), high-quality RNA samples with RIN number > 7.0 were used to construct sequencing library ...
-
bioRxiv - Pathology 2020Quote: ... Mutations required for domain excision and/or punctual changes within P1 nucleotidic sequence were introduced in the P1 open reading frame using the QuikChange® II XL Site-Directed mutagenesis kit (Agilent-Stratagene) and related primers (Appendix Table 1) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... YFP-tagged DAT-PG584,585AA was created by introducing the substitutions with created with the QuikChange Lightning Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), using wild type YFP-fagged DAT as the template ...
-
bioRxiv - Molecular Biology 2021Quote: ... Each extracted pool of RNA was labeled separately with cy3 and cy5 dyes using the Low Input Quick Amp Labelling Kit (Agilent Technologies, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... The presence of each amplicon and consistency among reactions was evaluated by electrophoresis in Agilent BioAnalyzer DNA 12,000 kits (Agilent Technologies, CA, USA).
-
bioRxiv - Developmental Biology 2021Quote: For chimera RNA sequencing we first FACS sorted GFP-expressing 500 cells and used microcapillary electrophoresis on Agilent 2100 Bioanalyzer with RNA Pico 6000 kit (Agilent, 5067-1513) to analyze RNA quality (RIN values > 8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nucleotide substitutions from AT–AC to GT–AG in HD2C were introduced using the QuickChange Multi Site-Directed Mutagenesis Kit according to the manufacturer’s protocol (Agilent, https://www.chem-agilent.com/). The plasmids for the HD2B and DROL1 genes with nucleotide substitutions and insertions were obtained by inverse-PCR and self-ligation with specific primers ...
-
bioRxiv - Microbiology 2020Quote: ... The RNA integrity numbers (RIN) were obtained via the Agilent RNA 6000 Nano kit and the Agilent 2100 Bioanalyzer system (Agilent Technologies 2100), and all samples reached RIN > 9 (Supplementary Table 10) ...
-
bioRxiv - Microbiology 2021Quote: ... Each uniquely indexed strand specific library was assessed for library size and amount using the Agilent DNA 1000 kit (Agilent Technologies, USA). After normalization and pooling ...
-
bioRxiv - Cell Biology 2020Quote: ... All STIM1 variants were generated from the wild-type (WT) construct by site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, Massy, France). All resulting plasmids were checked by Sanger sequencing.
-
bioRxiv - Cell Biology 2020Quote: ... A 0.2 µg of total RNA was subjected to Cy3 labeling by in vitro transcription with use of Low Input Quick-Amp Labeling kit (Agilent Technologies, USA). Subsequently ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA quality and quantity were inspected on the Agilent 2100 Bioanalyzer using the Agilent RNA 6000 Pico kit (Agilent Technologies, Inc, Germany).
-
bioRxiv - Neuroscience 2021Quote: ... and library quality was assessed using the Agilent High Sensitivity DNA Kit (Cat.No. 5067-4626) on the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Immunology 2021Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (Patil et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Whole-exome sequencing libraries were prepared using SureSelectXT Human All Exon V5 + UTR kit (75 Mb; Agilent technologies, Santa Clara, CA, USA) as per manufacturer’s instructions and sequenced on HiSeq 2000 to generate paired end 2 × 100bp sequence reads (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... was derived from pcDNA-V5-hWls (EVI/WLS-V5, Belenkaya et al, 2008) using the QuikChange II Site-Directed Mutagenesis Kits (200523, Agilent Technologies Inc.) according to the manufacturer’s instructions and the primers CGGAACATCAGTGGGAGGCAGTCCAGCCTGCCAGCTATGAGCAGAGTCCGGCGGC and GCCGCCGGACTCTGCTCATAGCTGGCAGGCTGGACTGCCTCCCACTGATGTTCCG ...
-
bioRxiv - Cell Biology 2020Quote: ... E706A/E1015A and E437A/E706A/E1015A=EallA) were obtained by site-directed mutagenesis of pCS2-3×HA-NFATc3 using the QuickChange® II XL kit (Agilent Technologies) using the indicated primers ...
-
bioRxiv - Immunology 2021Quote: ... and quality control was performed on the Agilent 2100 Bioanalyzer with the High Sensitivity DNA Kit (Cat. No. 5067-4626; Agilent, Waldbronn, Germany). Mixed libraries were sequenced on a NextSeq550 with 2 × 75 bp paired-end reads.
-
bioRxiv - Genomics 2021Quote: ... and RNA integrity was determined with an RNA ScreenTape Kit on the TapeStation 2200 system (Agilent, 5067-5576, 5067-5578, 5067-5577). cDNA libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... The purity and content of total RNA were quantified using Bioanalyzer 2100 Spectrophotometers and RNA 1000 Nano LabChip Kit (Agilent, CA, USA). Total RNA was used for subsequent experiments if the total RNA samples met the following criteria ...
-
bioRxiv - Biochemistry 2022Quote: ... The phPAI-1 library was generated by error prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) with primers that maintain the AscI and NotI restriction sites (SI Table 1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The size of the collected DNA fragments was determined using a 2100 Bioanalyzer and the High Sensitivity DNA Kit (Agilent Technologies, Inc.). Libraries were run in the Rapid Run flow cell and sequenced with paired-end sequencing (2×76 bp ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Neuroscience 2022Quote: ... were used for each replicate and placed into 100 μL of lysis buffer + β-mercaptoethanol from the Absolutely RNA Microprep kit (Agilent Technologies). Each genotype was prepared in quadruplicate ...
-
bioRxiv - Physiology 2022Quote: ... extracellular acidification rate (ECAR) and other bioenergetic parameters were measured using the Agilent Seahorse XFp Mito stress test kit (Agilent, 103010-100). Baseline and stressed OCR and ECAR were determined prior and post-injection of stressor compounds ...
-
bioRxiv - Molecular Biology 2022Quote: ... Slides were then treated with biotinylated secondary antibodies and target staining was performed with peroxidase-conjugated streptavidin and DAB chromogen (Dako REAL Detection System Peroxidase/DAB+, Rabbit/Mouse Kit; Dako, Glostrup, Denmark). Mayer’s hematoxylin (Carl Roth ...
-
bioRxiv - Developmental Biology 2022Quote: ... Mutation of the highly cross-species conserved miR-483-3p seed target sequence from AGGAGUG to AGGAACG (mouse) was performed using the QuickChange Site-Directed Mutagenesis kit (Agilent Technologies – 200518). The HEK-293 cells were used for miR-483-3p expression studies ...
-
bioRxiv - Physiology 2024Quote: ... for assessment of the RNA integrity by the RNA 6000 Nano Chip Kit with the Agilent 2100 Bioanalyzer (Agilent Technologies, Waldbronn, Germany), and samples with RIN number above 7.5 were used for micro-array analysis ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... Probes produced from PCR templates were radiolabelled with [α-32P]-dCTP (Hartmann Analytic, #SRP-305) using Prime-it II Random Primer Labelling kit (Agilent, #300385) and oligonucleotides used as a probe were radiolabelled with [γ-32P]-ATP (Hartmann analytic #SRP-501) ...
-
bioRxiv - Physiology 2024Quote: cDNA encoding the mouse γ subunit was mutated to replace 140RKRR143 with 140QQQQ143 using the QuckChange II XL mutagenesis kit (Agilent Technologies). cDNAs encoding ENaC’s mouse α ...
-
bioRxiv - Immunology 2023Quote: ... Mutations were introduced into cDNAs using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent, Santa Clara, CA, USA; cat. no. 200521) to construct expression vectors for S variants with a single amino acid change ...
-
bioRxiv - Physiology 2024Quote: ... Library quality assessment was performed twice during the library generation protocol with the Agilent Bioanalyzer High Sensitivity dsDNA kit (Agilent; 5067-4626). Completed libraries were quantified with both the Qubit high sensitivity dsDNA kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNA-encoding genomic loci were amplified from up to 400 µg gDNA via PCR using a Herculase II Fusion Polymerase PCR kit (Agilent, Cat. #600677). Pooled reaction products from each treatment group were uniquely barcoded in a subsequent PCR reaction followed by electrophoresis on 2% TBE-agarose gel at 120 V ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final sequencing libraries were quantified using a Qbit DNA HS kit (Thermo #Q32856) for concentration and a Bioanalayzer HS DNA chip (Agilent #5067-4626) for amplicon size ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA was checked pre and post poly(A)tail addition using an Agilent RNA 6000 Nano kit run on a 2100 BioAnalyser (Agilent Technologies, USA) (Fig ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA quality was determined by measuring the RNA integrity number (RIN) via the High Sensitive RNA Screen Tape Analysis kit (Agilent Technologies #5067) on the TapeStation system (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2024Quote: All mutants were generated by site-directed mutagenesis with the QuikChange XL II site-directed mutagenesis kit (Agilent, Santa Clara, CA, USA), as previously described (33).
-
bioRxiv - Cancer Biology 2024Quote: ... Drug was then washed out and 1x105 cells plated in 5 replicate wells for immediate analysis using the Mito Stress Test Kit (Agilent, 103015-100) according to the manufacturer’s instructions and using the following drug concentrations ...
-
bioRxiv - Cell Biology 2023Quote: Measurements of aerobic respiration and glycolysis were conducted with the Seahorse Bioscience XFe96 bioanalyzer using the seahorse XF Mito Stress Test Kit (Agilent #103015-100) and the Seahorse XF Real-Time ATP Rate Assay Kit (Agilent #103592-100) ...
-
bioRxiv - Cell Biology 2023Quote: ... GYF motif mutant GIGYF1 (GIGYF1 GYF Mut; G502A, Y503A, F504A) plasmids were created using the QuikChange II Site-Directed mutagenesis kit (Agilent Technologies, 200523). The chimeric constructs were synthesized by GenScript (Piscataway ...
-
bioRxiv - Neuroscience 2023Quote: ... targeted mutagenesis was performed on the cloned WT p38γ by using the Quick-Change Lightning site-directed mutagenesis kit (Agilent Technologies; 210518) to create the kinase dead mutant.
-
bioRxiv - Genetics 2023Quote: Exome enrichment was applied to the cDNA purified from the previous step by using probe kit SSELXT Human All Exon V8 (Agilent, 5191-6879) for human samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total amounts and integrity of RNA were assessed using the RNANano 6000Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Three independent biological replicates were performed ...