Labshake search
Citations for Thermo Fisher :
4101 - 4150 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... The GST tag was removed using PreScission Protease (Thermo Fisher Scientific, Cat. No. 88946). The His-ZmTPL2N-His recombinant protein was purified using Pierce Ni-NTA resin (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: ... a His6 tag for affinity purification using Ni-NTA Agarose Beads (Thermo Scientific Pierce). Full-length antibodies were purified using protein A agarose beads (Thermo Scientific Pierce) ...
-
bioRxiv - Biochemistry 2023Quote: ... or 1:6000 for a mouse monoclonal antibody against V5 tag (R960-25; Invitrogen) to detect V5tagged ANGPTL4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Flag-tag primer is GATTACAAGGATGACGACGATAAG) for 36 hours in Opti-MEM (31985062, Thermo Fisher) medium with 10 µL GeneTran III reagent (GT2211 ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibodies and reagents were used: anti-V5 tag (Invitrogen, 1:1000 dilution), anti-PLIN1 (Cell Signaling Technology ...
-
bioRxiv - Immunology 2022Quote: Antigen proteins with hexahistidine tags were purified with HisPurTM Ni-NTA resin (Thermo Fisher). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: ... Individual samples were then labeled with isobaric tags using commercially available TMTsixplex (ThermoFisher, 90061) kits ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isobaric labeling was performed using Tandem Mass Tag (TMTpro 16plex) reagents (Thermo Fisher Scientific). Labelled samples were combined into one pooled TMT set ...
-
bioRxiv - Immunology 2023Quote: ... 1:5000 and mouse anti-His6 tag polyclonal antibodies (Thermo Fisher, cat# 37-2900) 1:1,000 ...
-
bioRxiv - Biophysics 2023Quote: ... diluted at 1:5000 and mouse monoclonal anti-V5 tag (Thermo Fisher, #R960-25) diluted at 1:5000 for blotting.
-
bioRxiv - Evolutionary Biology 2023Quote: ... each labeled with a unique fluorescent tag (e.g., FAM, VIC, NED, PET; Applied Biosystems) to co-amplify multiple loci ...
-
Volumetric Compression Shifts Rho GTPase Balance and Induces Mechanobiological Cell State TransitionbioRxiv - Biophysics 2023Quote: ... and a dye-conjugated antibody anti-hemagglutinin (HA) tag-Dylight 488 (26183-D488, Invitrogen). The secondary antibodies used in this study are ...
-
bioRxiv - Cell Biology 2024Quote: ... HA Tag (26183, WB 1:5000, IF 1:200) was purchased from Thermo Fisher. Alexa Fluor 488/568/647 conjugated secondary antibodies for immunofluorescence were purchased from Thermo Fisher.
-
bioRxiv - Microbiology 2024Quote: ... or primary monoclonal antibodies against the 6His-tag (Thermo Fisher Scientific, Waltham, MA, USA). Membranes were then incubated with the alkaline phosphatase-conjugated goat anti-rabbit IgG (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: Acute slices were treated with sulfoNHS-SS-biotin (1 mg/ml, ThermoFisher, Waltham, MA) on ice for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... before removal of unreacted Alexa647 and biotin on a Zeba Spin column (ThermoFisher, 89891) equilibrated in 0.1 M sodium bicarbonate ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA was biotinylated by adding 200 μl Biotin-HPDP (Thermo Fisher Scientific #21341) dissolved to 1 mg/ ml in 30% DMF ...
-
bioRxiv - Plant Biology 2020Quote: ... DNA fragments labeled by biotin were separated on Dynabeads M-280 Streptavidin (ThermoFisher, USA), then purified ...
-
bioRxiv - Immunology 2019Quote: ... IgG was biotinylated by EZ-Link Sulfo-NHS-LC-Biotin kits (Thermo Fisher Scientific). Different amounts of biotinylated IgG was linked into RBCs through SA-biotin interaction at RT for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... the beads were incubated with 25 µM of NHS-PEG4-biotin (Thermo Scientific, A39259) in CSF-XB buffer for 1 h at 4°C ...
-
bioRxiv - Biophysics 2019Quote: ... (3) antibody solution consisting of 100 μg/ml biotin tubulin antibodies (Thermo Fisher Scientific) in PBS that bind specifically to the F(ab’)2 fragments (incubation time 5 min) ...
-
bioRxiv - Genetics 2019Quote: ... and the biotin-labeled fragments were selectively captured by Dynabeads Myone Streptavidin C1 (Invitrogen). The resulting libraries were used as template for the llumina amplification by PE-PCR primers and paired-end sequenced on a NextSeq500 Illumina platform ...
-
bioRxiv - Immunology 2020Quote: ... Cells were washed in PBS/10% FBS and incubated with Dynabeads Biotin Binder (ThermoFisher) for 40 minutes according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... The lineage-stained cells were incubated with Biotin Binder Dynabeads (Thermo Fisher Scientific, 11047), and lineage-negative cells were harvested using a magnet according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... The lineage stained cells were incubated with Biotin Binder Dynabeads (Thermo Fisher Scientific, 11047), followed by magnetic depletion according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... A biotin-labeled cRNA probe was generated using GeneChip 3’IVT Express Kit (Affymetrix). The probe was hybridized with a custom-made microarray (Marmo2a520631F ...
-
bioRxiv - Biochemistry 2020Quote: ... 7.5 μg/mL human IgG and 50 μg/mL BSA-biotin (Thermo Fisher Scientific) were also printed to serve as a printing control and “intra-well signal normalizer” ...
-
bioRxiv - Bioengineering 2020Quote: ... 250 μg of fusion proteins were mixed to 50 μg of Biotin-NHS (Invitrogen) in a total volume of 1 mL ...
-
bioRxiv - Biochemistry 2020Quote: ... Porcine mucosal heparin was biotinylated at the reducing end using hydroxylamine biotin (ThermoFisher, UK) as described by Thakar et al ...
-
bioRxiv - Biophysics 2021Quote: ... Unreacted biotin was removed with Zeba Spin Desalting Columns (7 MWCO, Thermo Fisher Scientific). Biotin-labeled proteins were immobilized on the streptavidin (SA ...
-
S-nitrosoglutathione reductase deficiency causes aberrant placental S-nitrosylation and preeclampsiabioRxiv - Physiology 2021Quote: ... Each sample was divided and labeled with either 1 mM biotin-HPDP (ThermoFisher Scientific) or 0.3 mM iodoTMT6 (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Biotin-labeled virions were detected using Pierce Streptavidin conjugated to HRP (Strep-HRP; ThermoFisher), followed by detection with Ultra-TMB substrate.
-
bioRxiv - Cell Biology 2021Quote: ... and the biotin-labeled DNA fragments were enriched by Dynabeads M280 beads (Thermo Fisher). The enriched DNA library was amplificated by PCR using Q5 DNA polymerase (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... Unreacted biotin was removed with Zeba Spin Desalting Columns (7 MWCO, Thermo Fisher Scientific). Biotin-labelled proteins were immobilized on the streptavidin (SA ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with BioID vector and incubated with 50 μM Biotin (Invitrogen, B20656) during interphase and mitosis synchronization.
-
bioRxiv - Biochemistry 2022Quote: ... and incubated with 1 mg/mL EZ-Link Sulfo-NHS-LC-Biotin (Thermo Fisher) in order to biotinylate cell surface proteins ...
-
bioRxiv - Immunology 2022Quote: ... Excess biotin was subsequently removed using Zebra Spin Desalting Columns 7K MWCO (Thermo Fisher) and protein was quantified with a Pierce BCA Assay (Thermo Fisher) ...
-
bioRxiv - Genomics 2022Quote: ... Biotin-labelled probes were detected with 2.0μg/ml streptavidin conjugated to Alexa594 (Molecular Probes), and digoxigenin probes were detected with 4μg/ml anti-digoxigenin conjugated to FITC (fluorescein isothiocyanate ...
-
bioRxiv - Plant Biology 2021Quote: ... Migration of biotin-labeled probes was detected using the enhanced chemiluminescence substrate (Thermo Scientific) on a ChemDoc XRS system (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... and rabbit anti-rat IgG biotin-SP (31834, 1:200, Thermo Scientific, Rockford, IL), respectively ...
-
bioRxiv - Biochemistry 2020Quote: ... Porcine mucosal heparin was biotinylated at the reducing end using hydroxylamine biotin (ThermoFisher, UK) as described by Thakar et al ...
-
bioRxiv - Immunology 2022Quote: ... was biotinylated using EZ-Link Sulfo-NHS-LC-Biotin (Thermo Scientific catalog no. 21335) and desalted with a Zeba quick spin column (Thermo Scientific catalog no ...
-
bioRxiv - Immunology 2022Quote: ... unbiotinylated form were incubated with 2μg/mL anti-His biotin (Invitrogen, MA1-21315-BTIN) for 20 min at room temperature before being used to label the streptavidin beads ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in PBSCM containing 0.5mg/mL Sulfo-NHS-SS-biotin (Thermo Scientific, 30min, 4℃), then rinsed in ice-cold PBSCM ...
-
bioRxiv - Genomics 2022Quote: ... and was labeled by incubating with Biotin-14-dATP (Thermo Fisher Scientific, Massachusetts, USA) and then ligated by T4
-
bioRxiv - Molecular Biology 2019Quote: ... Biotin-labelled RNA was then purified using MyOne Streptavidin C1 Dynabeads (Thermo Fisher Scientific) and decapped using Tobacco Acid Pyrophosphatase (TAP ...
-
bioRxiv - Immunology 2019Quote: ... Recombinant proteins were biotinylated with EZ-Link Sulfo NHS-LC-LC biotin (Thermo Fisher) at a 50 molar excess for 30 minutes at room temperature ...
-
HIV-1 Nef interacts with LMP7 to attenuate immunoproteasome formation and MHC-I antigen presentationbioRxiv - Microbiology 2019Quote: Purified LMP7 proteins from bacteria were linked with NHS-LC-LC-biotin (Thermo Fisher) as a 1:3 molar ratio at room temperature for 1 h ...
-
bioRxiv - Biophysics 2020Quote: ... Unreacted biotin was removed with Zeba Spin Desalting Columns (7 MWCO, Thermo Fisher Scientific). Biotin-labeled proteins were immobilized on the streptavidin (SA ...
-
bioRxiv - Molecular Biology 2020Quote: ... according to the manufacturer’s protocol with addition of 0.75 mM Biotin-14-CTP (Invitrogen) to the transcription reaction ...