Labshake search
Citations for Thermo Fisher :
4351 - 4400 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Samples were adjusted to 400 ng total RNA and spiked with diluted 1/100 ERCC Spike-In Mix (4456740, Invitrogen) and Drosophila melanogaster ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 x 107 mESCs and 1 x 107 Drosophila Sg4 Cells (20% cellular spike-in) were carefully counted using a Countess 3 Automated Cell Counter (ThermoFisher) and pooled ...
-
bioRxiv - Neuroscience 2020Quote: ... tdTomato sequence was added to the genome) using the cDNA labels combined with the 96 ERCC spike-in controls (Ambion). Median assignment rate was 61% (±10% S.D.) ...
-
bioRxiv - Cell Biology 2021Quote: ... The viral spike protein was stained with an in-house developed rabbit anti-spike antibody and goat anti-rabbit IgG (H+L) highly cross-adsorbed antibody with Alexa Fluor 488 (Invitrogen). Images were acquired using FluoView FV10i Confocal Laser Scanning Microscope (Olympus) ...
-
bioRxiv - Plant Biology 2020Quote: ... was applied to extract total RNA from immature spike tissues followed by removal of genomic DNA contamination using RNAse-free DNAse (Invitrogen). RNA integrity and quantities were analyzed via Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was isolated from 9 µl lysate and 1 µl of ERCC 1:1000 Spike in control (Thermo Fisher Scientific) per sample using RNA SPRI beads (Agencourt ...
-
bioRxiv - Microbiology 2020Quote: ... containing a 1/250 dilution of Alexa 488-conjugated anti-Spike antibody (GTX632604 conjugated using the Zenon Alexa Fluor 488 Mouse IgG Labeling Kit, ThermoFisher) and washed 4 times in FACS buffer ...
-
bioRxiv - Immunology 2022Quote: ... Expression plasmids for Omicron sublineage spike proteins were produced by assembling and cloning codon-optimized overlapping gene fragments (Thermo Fisher) into the pCDNA3.1/V5-HisTOPO vector (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each cDNA library was built using 10 ng total RNA spiked with ERCC spikes (AM4456740) diluted 1:5,000 in UltraPure H2O (InVitrogen 10977023) containing carrier tRNA (AM7119 ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA libraries were prepared from the resultant rRNA depleted RNA and 1 ul of a 1:500 dilution of ERCC RNA Spike in Controls (Ambion® Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: Labeled synthetic RNAs and synthetic control RNAs are derived from selected RNAs of the ERCC RNA Spike-in Mix (Ambion) as described in 26 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA (5 µg) was combined with ERCC Spike-In Standards (5 µl of 1:50 diluted stock solution; Invitrogen) and submitted to the University of Minnesota Genomics Center for library generation and sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20ng of totalRNA was used for library preparation with ERCC Spike-in control Mix A (Ambion 10-6 final dilution). All steps were performed on a Tecan EVO150 ...
-
bioRxiv - Biochemistry 2020Quote: ... serum reactivity to the Spike protein was measured using an HRP-conjugated goat anti-human IgG (H+L) (Invitrogen, 31410) at a 1:3000 dilution for 1 hour ...
-
bioRxiv - Genomics 2020Quote: ... cDNA libraries were prepared from ~450ng of total RNA plus ERCC spike-in synthetic RNA controls (Ambion, dilution 1:100), purified using Ampure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2022Quote: ... VTWFHAIHVSGTNGT31) immunodominant spike peptides (1 μg/mL) overnight at 37°C in the presence of Brefeldin A (1:500, Invitrogen). The following day ...
-
bioRxiv - Microbiology 2022Quote: ... 3 µg RNA for each sample were mixed with 6 µl of ERCC ExFold RNA spike-in mixes diluted to 1:100 (Invitrogen). Next ...
-
bioRxiv - Cancer Biology 2024Quote: ... were carried forward for library prep using QuantSeq Forward kit (LEXOGEN #015.96) with 500 ng input material and ERCC ExFold RNA Spike-In Mixes (ThermoFisher #4456739). Sequencing was carried out on a HiSeq4000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were transfected with pcDNA4TO HMM-HA-Spike and pcDNA tagBFP for transfection marker using ExpiFectamine 293 (Thermo Fisher Scientific). Cells were centrifuged at 200 g for 2 min 48 h after transfection and washed with Dulbecco’s phosphate buffered saline (PBS ...
-
bioRxiv - Immunology 2023Quote: ... washed twice and incubated with a mixture of Hu-1 and BA.1 Spike +/− Hu-1 and BA.1 RBD tetramers in 100 μL of PBS (Gibco)-2% FBS during 40 min on ice ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA (500 ng) was spiked-in with 1 µl of a 1:100 dilution of ERCC Spike-In Mix (ThermoFisher) prior to library preparation ...
-
bioRxiv - Immunology 2023Quote: ... The full-length spike proteins were stabilized by introducing 2 prolines at amino acid positions 986 and 987 (Spike 2P) and transiently transfected in FreeStyle 293-F cells using Turbo293 (SpeedBiosystems) or 293Fectin (ThermoFisher). The constructs contained an HRV3C-cleavage site followed by His and/or streptagII tags for purification purposes ...
-
bioRxiv - Immunology 2023Quote: ... 25 µg of Spike protein was biotinylated according to the instructions of EZ-LinkTM Micro Sulfo-NHS-LCBiotinylation Kit (ThermoFisher). Then fluorescent (APC ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293T cells were seeded in a 10 cm dish and transfected with 12 μg pcDNA3.1 Spike plasmid using Lipofectamine 2000 (Thermo Fisher). Forty-eight hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... and transfected with 50 ng of pcDNA3.1-SC2-spike and 50 ng of pCG1-ACE2 plasmid using Lipofectamine 2000 (Invitrogen™) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA (10 ng) was used for amplification of the spike gene with Phusion hot Start II High-Fidelity PCR Master Mix (ThermoFisher) using primers 5’-CTCGAACAACTAATATCCTGTC-3’ and 5’-GTTCTTACTATCCCACATCGAG-3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... Input was 4.5 ul of input RNA plus 0.5 ul of ERCC RNA Spike-In Mix (Thermo Fisher Scientific 4456740) pre-diluted 1:10,000 in water ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 ug chromatin (750 ng of Drosophila chromatin for spike-in for H3K36me329) was precleared with protein G agarose beads (Invitrogen). Genomic DNA regions of interest were isolated using 4ul of H3K36me3 (Active Motif cat# 61101 ...
-
bioRxiv - Microbiology 2023Quote: ... 100 ng of spike HexaPro plasmid and 1.5 µl of Lipofectamine 2000 were separately diluted in 50 µl Opti-MEM (Gibco #31985070) before mixing together ...
-
bioRxiv - Biophysics 2020Quote: HeLa and HEK293 cells were cultured at 37°C in an atmosphere of 5% CO2 in air in DMEM (Gibco, #10566024) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting HEK293 based stable cells were grown and maintained in adherent cell culture in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher Scientific) supplemented with 9% Fetal Bovine Serum (FBS ...
-
bioRxiv - Genomics 2020Quote: ... 10 ng of the library were transfected into 250 000 HEK293 cells in one well of a 6-well plate using Lipofectamine 2000 (11668027, ThermoFisher Scientific) and OPTIMEM I Reduced Serum Medium (31985-047 ...
-
bioRxiv - Biophysics 2019Quote: HEK293 cells were grown in 1:1 Dulbecco’s Modified Eagle’s Medium (DMEM)/F-12 Ham with Glutamax+ (ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (Alkali Scientific ...
-
bioRxiv - Biophysics 2019Quote: Human embryonic kidney cells 293 (HEK293-6E, NRC, Canada) were cultured in FreeStyle F17 expression medium (Thermo Fisher Scientific, Waltham, MA) supplemented with 2 mM L-glutamine (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... The P2 baculovirus produced in Sf9 cells was added to HEK293 GnTI- cells (mycoplasma test negative, ATCC #CRL-3022) and grown in suspension in FreeStyle medium (GIBCO-Life Technologies) supplemented with 2% FBS at 37°C and 8% CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant vectors were transfected in HEK293 cells with 10 nM of miRNA mimics (miR-3594-5p, mature sequence: CCCAGGGCAGAGCAGUGUGAA; miR-negative control, ThermoFisher scientific) with Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... N-terminal FLAG-tagged human MCC (P23508-1) constructs (pCMV2B vector) were transfected into HEK293 cells and selected with G418 (Gibco #10131035). G418-resistant cells were grown ...
-
Micro RNAs are minor constituents of extracellular vesicles and are hardly delivered to target cellsbioRxiv - Cell Biology 2020Quote: ... the EBV-positive Burkitt lymphoma cell line Raji and the HEK293-based EBV producer cell lines were maintained in RPMI medium 1640 (Life Technologies). HEK293T cells were maintained in DMEM (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: LC-MS/MS analyses were conducted using either a QExactive Plus Orbitrap (QE, RNase-digested polysomes) or a Velos Pro Elite Orbitrap (Elite, virus polysomes and HEK293 aggregates) mass spectrometer (Thermo Fisher) coupled online to a nanoAcquity UPLC system (Waters Corporation ...
-
bioRxiv - Neuroscience 2020Quote: MARK4 expressed in HEK293 cells was immunoprecipitated from the cell lysate with monoclonal anti-Myc antibody (4A6) and Dynabeads protein G (Thermo Fisher). Its kinase activity was measured using human 2N4R tau ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, USA), penicillin ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: African green monkey kidney epithelial cells (Vero, ATCC) and HEK293 T cells (ATCC) were cultured in DMEM containing 10% fetal bovine serum (FBS, Gibco Invitrogen) at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: All transfection experiments were performed in HEK293 FT and cell lines using an optimized Lipofectamine 3000 transfection protocol (Life Technologies, L3000015). For RNA silencing in 293 HEK ...
-
bioRxiv - Microbiology 2020Quote: HEK293 FT (ATCC CRL-3216) and VERO (ATCC CCL-81) cell lines were cultured in DMEM high glucose media (Life Technologies) containing 10% heat-inactivated fetal bovine serum (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: All E2 cores (E2c3, E2mc3, and E2mc3 v1-v10) and E2p-based nanoparticles were transiently expressed in HEK293 F cells (Thermo Fisher) for biochemical ...
-
bioRxiv - Immunology 2021Quote: ... IgGs and 6xHis-tagged Fabs were expressed by transient transfection of paired heavy chain and light chain expression plasmids into HEK293-6E or Expi293 cells (Life Technologies). Fabs and IgGs were purified from transfected cell supernatants using Ni-NTA (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... a heavy chain (HC) and light chain (LC) plasmid was generated for co-expression in HEK293 suspension culture cells (Expi293F cells) (Fisher Scientific). For species specificity swapping experiments ...
-
bioRxiv - Microbiology 2020Quote: ... NP presenting BG505 V1V2 and a trimeric scaffold (1TD0) presenting ZM109 V1V2 were transiently expressed in N-acetylglucosaminyltransferase I-negative (GnTI-/-) HEK293S cells (Thermo Fisher) (41) ...