Labshake search
Citations for Thermo Fisher :
3951 - 4000 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... coli DY330 genomic DNA (for primers see Table S1) and purified with GeneJET Gel Extraction and DNA cleanup micro kit (PCR cleanup protocol, ThermoFisher). For binding 2.85 pmoles of DNA fragment was mixed with increasing amount of purified EcTopoI (0-16 pmoles and 0-32 pmoles correspondingly ...
-
bioRxiv - Genomics 2019Quote: ... a range of primers were tested (supplementary material, table S1) using Invitrogen Superscript III Platinum One-step Quantitative RT-PCR kit (Invitrogen) in a standard 25 µL reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were either single-transfected or triple-transfected (detailed in Tables S1 and S2, supplementary information) using Lipofectamine 2000 (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Primers designed to gene body acetylation peaks (Supplementary Table S1) were used for qPCR with PowerUp SYBR Green (Applied Biosystems) in order to determine pulldown percent relative to input ...
-
bioRxiv - Neuroscience 2020Quote: ... S1 domain) were added in CAD cell complete media supplemented with 1 nM of mouse VEGF-A165 (Cat# RP8672, Invitrogen) and left at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2021Quote: ... pINDUCER10 expressing shRNAs (Table S1) was transiently transfected in Akata-BX1 cells using TurboFect™ transfection reagent (Thermo fisher scientific) according to the manufactures protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA from S1 and S2 fractions of sorted cells was extracted using Proteinase K treatment (200µg/ml, Thermo Scientific, EO0491) followed by phenol-chloroform extraction and sonicated to a size of 500-1,000 base pair (bp) ...
-
bioRxiv - Neuroscience 2022Quote: Using a subcloned and sequenced PCR fragment (162 bp – Table S1) of the mouse 5-HT2AR cDNA (Zero Blunt TOPO PCR Cloning kit, Invitrogen), high specific-activity RNA probes were produced from a linearized plasmid (HindIII ...
-
bioRxiv - Biophysics 2022Quote: The GyrA14-E487C and the CcdA50-72 peptide (Table S1) were labeled with Fluorescein-5-Maleimide and 5-TAMRA (Tetramethylrhodamine-5-Maleimide) from ThermoFisher Scientific as per the manufacturer’s protocol as described previously (Aghera et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The precleared lysates were then incubated at 40C overnight with the immunoprecipitating antibody (Supplementary Table S1) or with the IgG isotype control {Rabbit Isotype Control (Thermofisher, Cat ...
-
bioRxiv - Immunology 2022Quote: ... Isoforms of XBP1 were detected using non-quantitative RT-PCR using the primers listed in table S1 and Phusion High-Fidelity PCR Master Mix (ThermoFisher) with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Forward and reverse oligos of 66 bases in length corresponding to the DNA templates for in vitro transcription of shRNAs (Supp. Table S1) were ordered from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 25x104 cells were transfected with 10 nM of the indicated oligonucleotides in Table S1 using the Lipofectamine RNAiMAX transfection reagent (Invitrogen). 72 hours after siRNA transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... targeting the transcript of interest (see Supplementary Table S1) or non-targeting siRNA as control by using Lipofectamine RNAiMax (Invitrogen) as transfection reagent ...
-
bioRxiv - Cell Biology 2022Quote: ... Rabbit anti-mSin3a (PA1-870), HDAC7 (PA5-29937) and Ki-67 (SP6, RM-9106-S1) were purchased from Thermo Scientific. Rabbit anti-cleaved caspase 3 (#9664) ...
-
bioRxiv - Microbiology 2022Quote: The CARP assay was performed by using 1μl of 1:1 diluted in vitro Cas9/gRNA cleavage reaction mix as template and rpoB specific primers 1321 and 1154 (Table S1) with the help of SYBR Green PCR Master Mix as per manufacturer’s recommendation (Applied Biosystems). Detection of presence of mutation was determined by comparing the Ct values of the reaction sample with the Ct values of the respective DNA template alone.
-
bioRxiv - Molecular Biology 2022Quote: ... was amplified with the modified oligonucleotide primers listed in Supplementary Table S1 for subsequent integration into the GATEWAY pDONR/Zeo vector system (Invitrogen) using initial denaturation for 7 min at 94°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL of cell ‘lysate’ was directly used for cDNA generation using HT_RT primer (table S1) and SuperScript IV reverse transcriptase (Thermo Fisher). Following cDNA synthesis ...
-
bioRxiv - Neuroscience 2024Quote: ... Positive control cells were set aside during the first stages of the reprogramming procedures (fig. S1, Cat Nº A16517, ThermoFisher).
-
bioRxiv - Microbiology 2024Quote: ... Amplicons were obtained using a set of primers defined on contig sequences (Table S1) with the PCR Kit phusion hight fidelity (Thermofisher) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: The quantification of the total amount of soluble tau in S1 fractions was performed by using an ELISA kit (human Tau, Invitrogen), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... two nested RACE PCRs (primer combinations listed in Table S1) using cDNA attached to oligo (dT)25 Dynabeads (ThermoFisher Scientific) as a template ...
-
bioRxiv - Biophysics 2024Quote: The original CC1 construct with super ecliptic pHluorin (SE) A227D (31) or CC1 variants with mutations in S1 were expressed in HEK 293 cells via lipofectamine (Invitrogen). Coverslips with transiently transfected cells were placed into a bath chamber (Warner instruments ...
-
bioRxiv - Cell Biology 2024Quote: ... HK-2 cells grown on 12mm glass coverslips were transfected with 50-100ng of LAP-WHAMM(WT) or LAP-WHAMM(W807A) (Supplemental Table S1) using LipofectamineLTX with Plus reagent (Invitrogen) diluted in DMEM ...
-
bioRxiv - Plant Biology 2023Quote: ... 2000 bp upstream of the PIF7 start codon were amplified by PCR using the primers listed in Supplementary Table S1 and cloned into the pDONR P4-P1R vector (Invitrogen) by Gateway BP recombination reaction (Invitrogen) ...
-
bioRxiv - Plant Biology 2023Quote: ... were amplified from Petunia x hybrida R27 genomic DNA with primers from Table S1 and cloned into pCR-BluntII-TOPO (ThermoFisher). Binding sites were amplified from these plasmids with primers listed in Supplementary Table 1 ...
-
bioRxiv - Plant Biology 2023Quote: ... For C-terminal fusions the CDS of PYE and OLV versions were amplified from cDNA of Fe deficient Arabidopsis WT roots with primer pairs PYE_B1 fw/PYEns_B2 rev and OLV_B1 fw/OLVns_B2 rev carrying B1 and B2 attachment sites without stop codon or from existing pDONR with N-terminal fusion (Supplemental Table S1) and transferred via Gateway cloning into pDONR207 (Invitrogen) according to the manual (Gateway ...
-
bioRxiv - Plant Biology 2023Quote: ... The CDS of PYE and OLV were amplified from cDNA of Fe deficient Arabidopsis WT roots with primer pairs carrying B1 and B2 attachment sites (Supplemental Table S1) and transferred via Gateway cloning into pDONR207 (Invitrogen) according to the manual (BP reaction ...
-
bioRxiv - Immunology 2023Quote: Cells were stained in PBS containing fluorophore-conjugated antibodies (Table S1) and LIVE/DEADTM Near-IR dye (Thermo Fisher Scientific) (1:500 ...
-
bioRxiv - Plant Biology 2023Quote: ... AtSMXL5 and AtSMXL6 CDS were PCR amplified from Arabidopsis Col-0 cDNA and with the primers specified in Supplemental Table S1 and then recombined into the pDONR221 vector (Invitrogen). PpSMXLB and PpSMXLC CDS were obtained as described above ...
-
bioRxiv - Plant Biology 2024Quote: ... The obtained amplicons were fused in a PCR with primers AM 431/AM 428 (Table S1) and the product was recombined with pDONR/Zeo vector using Gateway cloning system (Invitrogen). The resulting constructs AM 556 (Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... A 25pg aliquot of External RNA Controls Consortium (ERCC) RNA Spike-In Mix (Ambion, ThermoFisher Scientific, Carlsbad, CA, USA) was added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... Expression vectors encoding the spike protein cDNA were directly transfected into 16HBEo− with Lipofectamine P3000 according to manufacturer’s recommendations (Invitrogen). Transduced and transfected 16HBEo− cells were grown at 37 °C and 5 % CO2 for additional 48 h prior to harvest.
-
bioRxiv - Molecular Biology 2020Quote: ... 3.125 μM Oligo-dT30VN (IDT, 5’AGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Dissociated cells were sorted directly into 96-well plates containing lysis buffer with ERCC RNA spike-in controls (ThermoFisher). The details about the sorted cell populations ...
-
bioRxiv - Genomics 2019Quote: ... total mRNA from equal cell numbers was mixed with synthetic RNA standards (ERCC RNA Spike-In Mix, Thermo Fisher) (Jiang et al ...
-
bioRxiv - Microbiology 2019Quote: 40 ng of RNA was amended with 8 μl of a 10,000X dilution of External RNA Control Consortium47 (ERCC) Spike-In Mix 1 (Ambion). The ERCC mix consists of 92 transcripts ranging from 250 to 2,000 nt in length with a large dynamic fold range ...
-
bioRxiv - Immunology 2020Quote: ... 1 μl of a 1:4000 dilution of ERCC (External RNA Controls Consortium) spike-in mix (Ambion, Life Technologies) was added to the lysis reagent ...
-
bioRxiv - Immunology 2020Quote: ... 1 μl of a 1:4000 dilution of ERCC (External RNA Controls Consortium) spike-in mix (Ambion, Life Technologies) was added to the lysis reagent ...
-
bioRxiv - Microbiology 2021Quote: ... and 1 μl of a 1:100 dilution (corresponding to 4.7 aM of ERCC-0016) of RNA spike-in mix 1 (External RNA Control Consortium (32) (Ambion)) was added before amplification was performed to monitor the technical performance of the assay showing linear amplification of specific probes (Fig ...
-
bioRxiv - Microbiology 2021Quote: ... 0.2 µl of a 1:20 x 106 dilution of ERCC Spike-in Control Mix 1 (Thermo Fisher Scientific) were added to the lysates of single parasites and libraries were prepared using SMART-Seq v.4 Ultra Low Input RNA Kit (Takara ...
-
bioRxiv - Developmental Biology 2022Quote: ... Each oocyte lysis was supplemented with 1 μl of the 1:105 diluted ERCC spike-in mix (ThermoFisher 4456740). Poly(A ...
-
bioRxiv - Immunology 2020Quote: ... cDNA libraries were prepared using 500 pg of total RNA and 1ul of a 1:200,000 dilution of ERCC RNA Spike in Controls (Ambion, Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... As recommended by the ENCODE (Encyclopedia of DNA Elements) consortium ERCC (External RNA Control Consortium) RNA spike-In (Invitrogen) were added to samples in order to ensure reproducibility of the experiments ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL of a 1:50 dilution of ERCC Spike-In mix (Ambion, Thermo Fisher Scientific, Wilmington, DE, USA) was added to each sample ...
-
bioRxiv - Genomics 2021Quote: ... 50 nL per well of lysis mix (0.07% IGEPAL, 1 mM dNTPs, 1:50,000 ERCC RNA spike- in mix (Ambion, 4456740)) was added ...
-
bioRxiv - Immunology 2021Quote: ... 293T Cells were transfected with the indicated Spike expression plasmids or a control plasmid using Lipofectamine 2000 (Life technologies). One day after ...
-
bioRxiv - Immunology 2021Quote: Avi-tag-biotinylated spike and RBD were incubated with subsequent fluorochrome-labeled streptavidin at 4:1.5 ratio overnight at 4 °C as follows: spike with APC-streptavidin (Invitrogen), Wuhan RBD with PerCP-Cy5.5-streptavidin (BioLegend) ...
-
bioRxiv - Immunology 2021Quote: ... RBD-His and Spike-his containing supernatants were batch purified using the HisPur™ Ni-NTA Resin (ThermoFisher Scientific). Supernatants were incubated with 6 ml of resin for 1h at RT ...