Labshake search
Citations for Thermo Fisher :
3051 - 3100 of 10000+ citations for Dengue Virus Serotype 3 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were washed 3 times with PBS where the second wash contained DAPI staining (dilactate, Invitrogen at 1:10,000). Coverslips were mounted onto glass slides using Fluoromount-G mounting medium (0100-01 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and cell viability was then determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cell viability assay (Invitrogen, USA) according to the manufacturer’s protocol 28 ...
-
bioRxiv - Immunology 2021Quote: ... Heat-inactivated sera (1:100 dilution) were serial diluted in 3-fold steps in cell culture medium (DMEM (Gibco), supplemented with 10% FBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human lung epithelial cell line Calu-3 was purchased from ATCC (HTB-55) and maintained in Eagle’s Minimum Essential Medium (EMEM, Gibco) supplemented with 10% fetal bovine serum and penicillin/streptomycin ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids (3 µg) were introduced into HEK 293 cells (1×106) by electroporation with Neon electroporator (Thermo Fisher Scientific) according to the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... Media was changed every 3 to 4 days and cells were passaged at nearly 90% confluence using 0.25% trypsin (Gibco). B16F0 cells were verified for mycoplasma contamination at Charles River Laboratories for cell line testing ...
-
bioRxiv - Neuroscience 2021Quote: ... Activated/Cleaved Caspase-3 (1:1000; Cell Signalling Biology, CAT#: 9661S and Thermo Fisher Scientific, CAT#: 66470-2-IG), Nestin (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... pVSV-ΔG-Luc was previously described.18 Calu-3 2B4 cells were grown in MEM (GIBCO, Grand Island, NY) supplemented with 20% FBS.
-
bioRxiv - Immunology 2021Quote: Sex and age-matched CD4+ T cells were enriched from CD45.1 and naïve control or RorcCre Tet1/3 mice using the Dynabeads untouched CD4 T cell kit (ThermoFisher Scientific), ensuring >85% purity ...
-
bioRxiv - Immunology 2020Quote: ... cells were incubated with sgRNA complementary to exon 3 of HVEM (GCCAUUGAGGUGGGCAAUGU + Scaffold, TrueGuide Synthtetic guide RNAs, Invitrogen™), Cas9 nuclease (TrueCut™ Cas9 Protein v2 ...
-
bioRxiv - Immunology 2022Quote: Supernatants were collected 3 days post Dynabeads™ Human T-Activator CD3/CD28 (1:1 beads:Treg cell ratio, Gibco) stimulation for analysis of cytokine production using a Luminex-based multiplexed assay (Th1/2/9/17 18-plex Human ProcartaPlex Panel ...
-
bioRxiv - Immunology 2022Quote: ... in the presence of T cells at a 1:1 effector:target cell ratio in the presence of the caspase-3/7 Green Detection Reagent (Invitrogen). Images were taken every 2 h at 10× magnification ...
-
bioRxiv - Neuroscience 2022Quote: ... Slides were rinsed 3 x 5 min and cell nuclei were labeled by DNA staining using Hoechst (Life Technologies) for 30 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... for Calu-3 (2.5×104 cells/well in 96well format) and forward transfections with Lipo3000 were done (Thermofisher, L3000015) for Caco-2 cells (1×104 cells/well in 96well format) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell proliferation was monitored every 24 or 72 hr for 3-7 consecutive days using CyQuant Reagent (Invitrogen, C35011) by measuring bottom-read fluorescence at 520 nm with excitation wavelength set at 480 nm using EnSight Multimode Plate Reader (PerkinElmer) ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were washed 3 times in PBS before addition of secondary antibody (Molecular Probes Cat# A-11008 (also A11008), RRID:AB_143165 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were washed with PBS 3 times then fixed with 4% paraformaldehyde (PFA) in 1x PBS (Thermofisher, cat#043368.9M) at room temperature for 15 min in the dark ...
-
bioRxiv - Neuroscience 2024Quote: ... and plated at 3×106 cell density per well into Nunclon Sphera 96 U bottom plates (#174929; ThermoFisher Scientific) and incubated at 37 °C with 5% CO2 ...
-
bioRxiv - Pathology 2024Quote: ... Cells were subcultured at a 1:3 to 1:6 ratio using Gibco TrypLETM Express Enzyme (12605010, Fisher Scientific) for cell dissociation ...
-
bioRxiv - Genomics 2024Quote: ... The RNP was combined with 100 pmol of ssODN donor and 100 pmol of electroporation enhancer v2 and delivered to 1.5e5 cells by Neon electroporation (1,400 V, 10 ms, 3 pulses; Neon Transfection System, MPK5000, Life Technologies). Immediately after electroporation ...
-
bioRxiv - Immunology 2024Quote: ... VH and VL plasmids were mixed at a 1:3 ratio and transfected into Expi293F cells (Thermo Fisher Scientific), which were cultured at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then washed with 1 × PBS and blocked in 3% BSA with 0.1% Triton-X 100 (ThermoFisher Scientific) and 0.1% Tween (Sigma ...
-
bioRxiv - Genetics 2023Quote: ... Around 3 x 105 cells were electroporated with 1 μg of each episomal vector using Neon Transfection System (Thermofisher). The emerging ESC-like colonies were manually picked and transferred into 96-well plates coated with rhLaminin-521 (Thermofisher Catalog#A29248 ...
-
bioRxiv - Microbiology 2023Quote: ... TREx BCBL1-Rta cells transduced with lentivirus were cultured in medium further supplemented with 3 μg/ml puromycin (ThermoFisher). KSHV lytic reactivation was induced in TREx BCBL1-Rta cells using 2 μg/ml doxycycline hyclate (Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... Following preset incubation times (0, 0.5, 1, 3, or 5 h) cells were harvested by trypsinization (500 μl TrypLE, Gibco) for 5 min at 37 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were then imaged and harvested at the 72-hour timepoint for real-time PCR analysis (ThermoFisher, QuantStudio 3).
-
bioRxiv - Cancer Biology 2023Quote: ... SKOV-3 cells were maintained in McCoy’s 5A media (HiMedia; AL057A) along with 10 % fetal bovine serum (Gibco; 10270), and OVCAR-3 cells were maintained in RPMI-1640 media (HiMedia ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were then washed 3 times in ice cold PBS and lysed in RIPA buffer (Thermo Fisher Scientific #89900). Samples were first resuspended in 4 volumes of a CHCl3:MeOH (1:1 ...
-
bioRxiv - Pathology 2023Quote: ... Placing them on 3% PBS-FBS pre-wetted 40 μm nylon cell strainers (Cat#352340, Thermo Fisher Scientific, USA) suspended over a 50 mL polypropylene tube ...
-
bioRxiv - Cell Biology 2023Quote: ... cells at passage 3-4 were seeded in to black walled clear bottomed 96 well plates (Pierce, ThermoFisher Scientific) at a density of 7,500 cells per well ...
-
bioRxiv - Cancer Biology 2023Quote: ... and counted before seeding for experiments using trypan blue in a Countess 3 Automated Cell Counter (Thermo Fisher Scientific). All cell lines were grown at 37°C with 5% CO2.
-
bioRxiv - Cell Biology 2023Quote: ... D3 cells were cultured in DMEM/F12 (3:1) medium supplemented with 10% fetal bovine serum (Thermo Fisher Scientific), 8 ng/mL Cholera Toxin (CELL technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... and then reinsertion into the NL4-3 backbone and transformation into Stbl4 electrocompetent cells (Thermo Fisher Scientific, Waltham, MA). Point mutations were inserted into NL4-3 from ordered gene fragments containing the desired mutations amplified by the amplification primers listed in Table 1 and ligated between the NheI to XhoI region of NL4-3 ...
-
bioRxiv - Bioengineering 2023Quote: Cell viability in printed structures was assessed after 3 days of culture using Live/Dead staining (Thermo Fisher Scientific). Live cells were stained with calcein AM (2 µM ...
-
bioRxiv - Cancer Biology 2023Quote: K562 cells were cytospun at 400 RPM x 3 minutes onto glass coverslips coated with Poly-L-lysine (Gibco) in a Thermoshandon Cytospin 3 centrifuge ...
-
bioRxiv - Neuroscience 2023Quote: ... The parental hiPS cell line (8858-3) was maintained in 6-well plates using StemFlex medium (Life Technologies, A3349401). Cas9 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by seeding of 2-3×106 cells onto T25 flasks (Thermo-Fisher Scientific; Cat. No. 12-556-009) coated with Matrigel ...
-
bioRxiv - Cell Biology 2024Quote: ... ∼250,000 cells were centrifuged at 100 rcf for 3 min and resuspended in 12 µl of electroporation buffer (Invitrogen). 50-100 ng of plasmid DNA were added to the cell suspension ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were passaged every 3-4 days during the log phase of growth with Trypsin/EDTA solution (Gibco, R001100) following a PBS wash ...
-
bioRxiv - Genomics 2023Quote: ... 3-4 days post-nucleofection (depending on cell confluency) selection was started using 400 ng/mL Puromycin (ThermoFisher A1113802) in FM (PFM) ...
-
bioRxiv - Cancer Biology 2023Quote: A549 cells grown in 96-well plates were stained with CellEvent Caspase 3/7 green detection reagent (Thermo Scientific) according to manufacturer’s instructions and the fluorescence measured using a plate reader at 488 nm wavelength ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were passaged 3 times per week at 1:10 dilution using Dulbecco’s Phosphate Buffered Solution (DPBS; Gibco 14190144) and trypsin (Gibco 25200072) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Viability was confirmed to be >90% in all samples using 0.4% Trypan Blue dye with Countess 3 Automated Cell Counter (ThermoFisher). Those organoids harvested under drug exposure with less than 70% viability were enriched by Dead Cell Removal Kit (Miltenyi ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell numbers were analyzed for 3 days successively using FluoReporter™ Blue Fluorometric dsDNA Quantitation Kit (Invitrogen™, F2962) as per manufacturer’s protocol and fluorescence measurements were taken with a Victor X (PerkinElmer ...
-
bioRxiv - Cancer Biology 2024Quote: ... SK-OV-3 cells were cultured in McCoy’s 5A medium (AL275A, HiMedia) supplemented with 10% fetal bovine serum (FBS) (10270, Gibco). OVCAR-3 cells were cultured in RPMI (AL162A ...
-
bioRxiv - Neuroscience 2024Quote: ... The pNL4-3 and EcoHIV/NDK plasmid amplification was accomplished using Stbl3 competent cells (Thermo Fisher Scientific, Cat# C737303). A total of 50 µg of proviral plasmid was transfected into 107 HEK293T/17 cells for virus production using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were washed 3×5 minutes and then mounted on Superfrost Plus slides (Fisher Scientific, Inc., Hampton, NH, USA), and cover-slipped with anti-fade medium (0.5% polyvinyl alcohol-DABCO ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were incubated with Protein-A beads (Thermo Fisher Scientific) conjugated with anti-p53 antibody or Mouse IgG at 4 °C overnight with gentle shaking ...
-
bioRxiv - Molecular Biology 2019Quote: ... protein was quantified using the Qubit Protein Assay Kit (Invitrogen). Antibodies used were ...
-
bioRxiv - Immunology 2021Quote: ... Total protein was measured by Pierce™ Protein Assay (ThermoFisher). Cytokine levels were standardized to total protein content.