Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Cys469 in the C-terminal DNase domain of these ColE9 constructs was labelled with a 3-fold Alexa Fluor 488-maleimide (Invitrogen) as previously described (41) ...
-
bioRxiv - Immunology 2021Quote: ... 4 million splenocytes cells were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 5’ – CCT GAA ATC GCT GAT GTG TAG TCG TCA GTC AGT GGC CAA AAC GAC TAC ACA AAT CAG CGA TTT C - 3’) obtained from Invitrogen. The miRNA plasmids were then sub-cloned into an AAV2 expression backbone downstream of a CMV promoter and of an EYFP reporter sequence ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 3 to 5 min at 37°C and resuspended in differentiation medium N2B27 (Advanced DMEM F12, Neurobasal vol:vol (Life Technologies)) ...
-
bioRxiv - Cell Biology 2021Quote: RBL-2H3 cells in a confluent 75 cm2 flask were washed and trypsinized for 8 min at 37 °C with 3 mL of 0.05% Trypsin-EDTA (Thermo Fisher). The detached cells were resuspended in 7 mL of growth medium and centrifuged to remove the medium ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 3 hr at 37 °C with 10 μg/mL recombinant laminin-521 (BioLamina, LN521-05) diluted in PBS+/+ (Gibco). Single-cell suspensions were then incubated for 3 hr at 37 °C in HUESM medium supplemented with 20 ng/mL bFGF and 10 μM Rock inhibitor Y27632 ...
-
bioRxiv - Neuroscience 2021Quote: ... They were incubated with 0.05% trypsin containing 0.05% EDTA at 37 °C for 20 mins and then washed 3 times with DRG growth medium (neurobasal media from Gibco) containing 2% B27 (Invtrogen) ...
-
bioRxiv - Immunology 2021Quote: ... 4 million cells per sample were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... 4 million isolated splenocytes or inguinal lymph node cells were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... Expi293F™ cells were seeded to a final density of 2.5-3 × 106 viable cells/ml and grown overnight at 37 °C in Expi293™ Expression Medium (Gibco). The following day ...
-
bioRxiv - Cancer Biology 2022Quote: ... minced skin was incubated at 37°C for 3 – 5 hours in 5 ml of DMEM high glucose (#41965-039; Gibco) supplemented with 10 mg ml-1 collagenase (#C9891 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was eluted in 100 µL of nuclease free water and precipitated at -80 °C for ≥ 3 hours with 1 µL of 15 mg/mL GlycoBlue coprecipitant (ThermoFisher), 10 µL of 3 M sodium acetate pH 5.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-15 μg poly(A)-selected mRNA was fragmented for 3 minutes at 70°C using alkaline hydrolysis fragmentation reagent (AM8740, Ambion). Fragmented mRNAs were purified by performing a 1.8X bead cleanup with RNAClean XP beads (A63987 ...
-
bioRxiv - Cell Biology 2023Quote: ... and the cell bodies were removed by centrifugation (1,150 g, 3 min, 4°C; Sorvall Legend XTR, Thermo Fisher Scientific). A sucrose cushion (10 ML of 25% sucrose in HMS ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cultured for 3 days under cold-shock conditions (32 °C/5% CO2) and in the presence of RevitaCell (ThermoFisher) and HDR enhancer (1 µM Alt-R HDR Enhancer v2 ...
-
bioRxiv - Immunology 2022Quote: ... Heat inactivated serum samples (56°C for 30 min) were serially diluted (3-fold) in minimum essential media (MEM; Gibco) supplemented with 1x Glutamax (Gibco) ...
-
bioRxiv - Molecular Biology 2024Quote: The transfection of a mixture of specific siRNA against c-Myc protein (exon 2 and exon 3, IDs s9129 and s9130, respectively; Ambion) and DOT1L protein (IDs s39011 ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA-treated cells were washed twice with 37°C M1 and replaced with M1 containing 1 μM TO-PRO-3 iodide (ThermoFisher) or washed once with 37°C M2 containing 5 mM ethylene glycol-bis(2-aminoethylether)-N ...
-
bioRxiv - Neuroscience 2023Quote: ... Homogenates were centrifuged for 25 mins at 35,000 x g and the supernatant was adjusted to approximately 3 mg/ml protein (Nanodrop 2000 C, Thermofisher Scientific). To capture the SVs for content detection ...
-
bioRxiv - Molecular Biology 2024Quote: ... The enteroids were then pelleted at 300 x g for 3 min at 4 °C and washed once with advanced DMEM/F-12 basal media (Gibco). The enteroid pellet was resuspended in the desired volume of IntestiCult complete medium (Stemcell Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... The clarified lysate was transferred to a 15 mL column containing 3 mL Ni-NTA Agarose affinity resin equilibrated with buffer A at 4 °C (Invitrogen). The column was washed using a gradient of Buffer A containing 20 mM ...
-
bioRxiv - Molecular Biology 2024Quote: Step 3 - exonuclease treatment: reaction was cooled down to 37°C and 10 U of Exonuclease I (# EN0581, ThermoFisher Scientific) and 50 U of Exonuclease III (#M0206L ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Molecular Biology 2023Quote: ... The grids were blotted for 3-5 s at 15-22 °C and 100% humidity in a Vitrobot Mark IV (ThermoFisher Scientific Inc. ...
-
bioRxiv - Developmental Biology 2023Quote: ... and aliquoted to 1 µg/µL in RNAse-free water at -80 °C for storage (concentration was determined using a Qubit 3 Fluorometer, Invitrogen).
-
bioRxiv - Developmental Biology 2023Quote: ... 5‘-AAA AAA AGC ACC GAC TCG GTG CCA C-3’) and in vitro transcribe using the MAXIscript T7 kit (Invitrogen) and purified with a miRNeasy mini kit (QIAGEN ...
-
bioRxiv - Biophysics 2024Quote: ... Individual reactions were heated to 65 °C for 5 min and transferred to ice for 3 min to facilitate annealing in SuperScript III reaction buffer (Invitrogen). After annealing ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were seeded at the coated chamber slides with a density 200000 cells per well and the next day four hours before imaging cells were stained with 1 µg/ml Hoechst 33342 for 30 min at 37°C and washed 3 times for 10 min each with Live Cell Imaging Solution (Invitrogen). When applicable ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... were incubated at 37°C for 2 h and analyzed by SDS-PAGE on a 3-8% tris-acete NuPAGE gel (Invitrogen) and stained with Pierce Silver Stain Kit (Thermo Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... These were then denatured for 3 minutes at 95°C and analyzed on an ABI 3730 instrument (Applied Biosystems Inc.) at the Veterinary Genetics Laboratory at the University of California ...
-
bioRxiv - Physiology 2024Quote: Mouse DRG neuron cultures were loaded for 30 min at 37 °C with 3 µM Fura-2 AM (Invitrogen F1221) in ES containing also 0.02% Pluronic F-127 and left to recover for about 10 min in ES before recording ...
-
bioRxiv - Microbiology 2022Quote: ... connected to a PepMap C-18 trap-column (0.075 x 50 mm, 3 m particle size, 100 pore size; Thermo Fisher) and an in-house-packed C18 column μ (column material ...
-
bioRxiv - Neuroscience 2022Quote: ... the cell cultures were washed 3 times with 37 °C DPBS+ and fixed using 4% w/v paraformaldehyde (PFA; Affymetrix) in PBS for 2.5 h ...
-
bioRxiv - Biophysics 2022Quote: ... CaVβ3-stable cells were grown in suspension at 37°C supplied with 8% CO2 in FreeStyle 293 Expression Medium (Gibco) supplemented with 2% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... 16 mL of HMA-10 buffer was added and the preparation was put on a shaking rocker for one hour at 4 °C with 3 units/mL Rnase-free Dnase (Ambion) added ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR primers used were 5′–3′ TCTCTTTTGAAGAAGAACGCCT and GCTTAAGCTGTTCTGACCGT and PCR was carried out with annealing temperature of 62°C using Platinum Superfi polymerase (Thermofisher) for 34 cycles.
-
bioRxiv - Developmental Biology 2024Quote: ... cell vials were thawed 2-3 min in a 37°C water bath and transferred in T25 cell culture flasks (Gibco) with 5ml of hASC culture medium containing Minimum Essential Mediun (αMEM ...
-
bioRxiv - Neuroscience 2024Quote: ... retinas were incubated with secondary antibodies at 4°C for another 2-3 days: goat anti-chicken antibody conjugated to Alexa Fluor 488 (1:1000; A11039, Invitrogen), goat anti-rabbit 555 (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... aspirated again and incubated for 3 min at 37°C in 2ml per flask of attenuated trypsin (0.025% (v/v) trypsin (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: OG1RF cultures were grown overnight in 3 mL of CBM at 37 °C and diluted 1:50 into an optically clear 96-well plate (Nunc MicroWell tissue culture- treated optical bottom plates) ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions were collected with a BioComp Piston Gradient FractionatorTM and portions corresponding to mitomonosomes (identified based on UV 260 trace and confirmed via western blot for MRPL12 and MRPS18B) were frozen @ −80°C in 3 volumes of TRIzolTM LS (Invitrogen). Footprints were then isolated using a Direct-zolTM RNA kit (Zymo ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 or 3 mg of protein was incubated for 1 hour at 4°C with 10 μl pre-washed dynabeads (Invitrogen) to clear the lysate from unspecific interactions ...
-
bioRxiv - Developmental Biology 2024Quote: E14.5 cortices from WT and Prdm16 KO embryos were dissected and incubated for 10 min at 37°C in 3 ml of 0.05% trypsin with EDTA (Gibco, 25300062) and 0.01% DNase (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... The primary antibody used in this study is mouse anti-EGFP (ThermoFisher, A11120). The secondary antibody used in this study was Alexa Fluor 488 goat anti-mouse (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: ... GFP plasmid is EGFP cloned into pcDNA DEST40 vector (Thermo Fisher Scientific 12274015). RIG-I plasmid DNA was generated by (Dittmann et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The DNA encoding for small synthetic RNA against EGFP was chemically synthesized (Invitrogen GeneArt Gene Synthesis service ...
-
bioRxiv - Immunology 2021Quote: ... eGFP and cell viability levels were quantified by propidium iodide viability staining (ThermoFisher) and flow cytometry (Attune ...
-
bioRxiv - Cell Biology 2021Quote: ... PLIN2-EGFP and PLIN5-mCherry using Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... for EGFP animals or Alexa Fluor 488-conjugated donkey anti-mouse IgG (Invitrogen) for the mCherry animal ...
-
bioRxiv - Neuroscience 2023Quote: ... RNP-EGFP solution was transferred to Lipofectamine CRISPRMAX Cas9 Transfection Reagent (ThermoFisher, CMAX00001) according to manufacturer’s instructions and applied to 6-well plates in drop-wise fashion ...