Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Dose-dependent effects of histone methyltransferase NSD2 on site-specific double-strand break repairbioRxiv - Cell Biology 2023Quote: ... the mouse Nsd2 coding region was introduced into pCAGIP-EGFP-gw with Gateway Technology (Invitrogen) (Nimura et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Human-Kinesin-1-EGFP-expressing Drosophila S2 cells were grown in Schneider’s medium (Life Technologies) supplemented with 10% heat inactivated fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... and the rabies viral genome vector pSAD-B19ΔG-EGFP using Lipofectamine 2000 (Thermo Fisher Scientific). For pseudotyping RVΔG with EnvA ...
-
bioRxiv - Cell Biology 2024Quote: ... and HaCaT cells were transfected with the nls-eGFP plasmid using Lipofectamine® 2000 (Invitrogen). For each transfection ...
-
bioRxiv - Biophysics 2024Quote: ... and 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydro (EDC, ThermoFisher). For BS3 crosslinking ...
-
bioRxiv - Cancer Biology 2021Quote: ... Peptides were injected into a C-18 trap column (Acclaim PepMap100, 75 μm i. d. x 2 cm, C18, 3 μm, 100 Å, Thermo Fisher Scientific) and further separated on a C-18 analytical column (Acclaim PepMap100 ...
-
bioRxiv - Molecular Biology 2021Quote: ... were transfected with viruses using a multiplicity of infection (MOI) of 3 at 27°C in SF-900™ II SFM media (Thermo Fisher Scientific). The cells were harvested 48 h after infection and stored at −80°C until purification.
-
bioRxiv - Developmental Biology 2022Quote: ... were equilibrated in 3 ml of IVC1 medium in an incubator with a humidified atmosphere of 5% CO2 at 37 °C (Thermo Scientific, Heracell 240i) for at least 12 h prior to 3E-uterus embryo culture ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then washed twice with PBS and incubated for 3 min at 37°C with 1 mg/ml Alexa Fluor™ 647-Dextran (Invitrogen, REF D22914) without preincubation or acid stripping ...
-
bioRxiv - Genomics 2022Quote: ... and incubated for 3 minutes at a 37° C humidified incubator with 200 μl of TrypLE Express Enzyme (Thermo Fisher. Cat. No. 12605028). The enzyme was neutralized by adding 3 ml of 10% FBS (Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated at 4°C for 3 hours on a rotator before being placed in a DynaMag™-2 magnetic rack (Thermo Scientific, 12321D) and washed twice with TBS+NP40 wash buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... were transfected with viruses using a multiplicity of infection (MOI) of 3 at 27°C in SF-900™ II SFM media (Thermo Fisher Scientific). The cells were harvested 48 h after infection and stored at −80°C until purification.
-
bioRxiv - Molecular Biology 2024Quote: ... 2 % SDS) for 30 minutes at 50 °C prior to reprobing using mouse anti-3-phosphoglycerate kinase anti-serum (Invitrogen-Molecular probes, A6457).
-
bioRxiv - Cell Biology 2024Quote: ... whole cell fractions and beads were either stored at −20°C or denaturised (LDS Sample buffer, 3% β-mercaptoethanol, 20 mM DTT (Thermo Fisher, 20290), 2 mM biotin ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: The EGFP-mRFP-LC3 plasmid (addgene, #21074) was transfected in Escherichia Coli DH5α competent cells (Invitrogen) using the heat shock method and Kanamycin (50 µg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... and transfected with plasmids (pCAGGS-EGFP and the px333 plasmids) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... they were transfected with EGFP tagged wt LA/A350P DNA along with Lipofectamine 2000 (Invitrogen, USA) in a ratio 1:1.5 ...
-
bioRxiv - Genetics 2022Quote: ... or eGFP (Aves cat. no. GFP-1020; secondary antibody: Invitrogen A21449 labeled with Alexa Fluor 647), mounted (Invitrogen ProLong cat ...
-
bioRxiv - Microbiology 2020Quote: ... the sequence of the plasmid EGFP-N was confirmed by sequencing (Gene Art–Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... pCMV-TMEM63B-IRES-eGFP construct was transfected into CHO cells using lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... pcDNA3.1-eGFP and pcDNA3.1-mCherry were obtained by cloning the corresponding string DNA fragments (ThermoFisher Scientific) into pcDNA3.1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... EGFP+ cells were collected into 60% Leiboviz’s L-15 medium (Thermo Fisher Scientific, Cat. No. 11415064) by FACSAria IIIucell sorter (BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... IGSF3 and EGFP expression vectors were generated using the pLenti6-V5/DEST vector (Thermo Fisher Scientific). The coding region of human IGSF3 was amplified using the primer sets listed in Table S3 ...
-
bioRxiv - Cell Biology 2024Quote: Kif9 fused to GFP (eGFP-Kif9) protein was expressed and purified from SF9 insect cells (Thermofisher). MTs purified from bovine brain tubulin were used for all motility experiments ...
-
bioRxiv - Evolutionary Biology 2023Quote: Total RNA was immediately extracted from 100,000 EGFP-positive cells isolated by FACS using Trizol (Invitrogen). Briefly ...
-
bioRxiv - Genetics 2023Quote: U2OS (ATCC) and Hep3B cells stably expressing EGFP-AR (34, 35) were cultured in DMEM (Invitrogen), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... This 4,905-nucleotide gene (Ku70-eGFP-Sun1ΔN) was synthesized and cloned into the pcDNA3.1+ plasmid (Invitrogen) using NheI and XhoI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: Cells were transfected with wild-type MeCP2-EGFP using Lipofectamine 3000 (Thermo Fisher Scientific cat. L3000008) and following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Rab7a and LAMP1 wt and mutant molecules tagged with EGFP using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2023Quote: ... mylf7:eGFP construct was generated by MultiSite Gateway assemblies using LR Clonase II Plus (ThermoFisher Scientific) according to standard protocols and using Tol2 kit vectors described previously 33 ...
-
bioRxiv - Neuroscience 2024Quote: ... [mouse] anti-orexin-A (1:1000, NovusBio, MAB763) and [rabbit] anti-eGFP (1:500, ThermoFisher, G1362). After primary antibody incubation slices were washed 3 times in 1X PBS for 15 minutes to remove non-specific binding ...
-
bioRxiv - Microbiology 2024Quote: ... HeLa RW cells were subsequently transfected with the EGFP-CVB construct using Lipofectamine 2000 (Thermo Fisher). After 48 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... The MAD1-EGFP construct under regulation of MAD1 native promoter cloned in the pMT backbone (Invitrogen) was a gift from Thomas Maresca (University of Massachusetts Amherst ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... DiIC12(3) (1,1’-Didodecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate) (Invitrogen, D383) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... mounting 3 dpf embryos in 3% methylcellulose (Thermo Scientific, 258111000). After imaging ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated overnight at 4°C in blocking solution (PBS, 2% normal goat serum, 3% BSA) and primary antibodies (mouse anti-HA, Invitrogen; rabbit anti-GFP, Invitrogen). Cells were then immunolabeled with Alexa-conjugated secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4μg of total RNA were loaded per well after denaturation by heating at 70°C for 3 minutes in sample buffer (Novex TBE-Urea sample buffer; Thermo fisher Scientific, Catalog# LC6876). Samples were electrophoresed using Novex 15% TBE-Urea Gels (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... followed by 40 cycles of 95 °C for 3 s and 60 °C for 30 s performed on a 7500 Fast Dx Real-Time PCR Instrument (Life Technologies, Grand Island, NY).
-
bioRxiv - Physiology 2022Quote: ... Brains were quickly transferred to 10 μL of the same saline in a 200 μL microcentrifuge tube kept at 2-3°C in a Boekel Scientific TropiCooler Benchtop Incubator (model 260014, Fisher Scientific, Ottawa, ON, Canada), and once 30 brains were collected (2-2.5 min per brain ...
-
bioRxiv - Physiology 2024Quote: Cardiac RNA was isolated from 3- and 18-week-old hearts that were stored at −80°C in 500 μL of RNAlater™ Stabilization Solution (Invitrogen, Cat. No. AM7020). Total RNA was isolated by homogenization with T10 basic ULTRA-TURRAX® (IKA) ...
-
bioRxiv - Cell Biology 2024Quote: ... was digested and dephosphorylated for 3 hours in a 60 µL reaction at 37 °C with FastDigest Esp3I and FastAP (ThermoFisher FD0454 and EF0654, respectively). Digested DNA was cleaned using the DNA Clean and Concentrator 5 kit ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... media plates and were grown under anaerobic conditions at 35°C for 3 nights (Oxoid Anaerojar with Anaerogen bags, Thermo Scientific, Waltham, MA, USA). A single colony of bacteria from each plate was cultured under anaerobic conditions (Anaerobic Hungate Culture Tubes with air displaced by CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... The lysate was centrifuged at 1000 g for 3 min at 4 °C to remove debris and then the supernatant was incubated with anti-HA magnetic beads (Thermo Fisher Scientific, cat. # 88837) for 6 minutes at 20 °C ...
-
bioRxiv - Neuroscience 2023Quote: P29 mice were anesthetized with isoflurane (1–3%) and 50 nl of the retrograde tracer cholera toxin subunit B (5% wt./vol in PBS, ThermoFisher Scientific, Cat # C-34775) were injected at 10nl/sec into the left SLM (ML ...