Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The constructs EGFP-CYCLIN BWT and EGFP-CYCLINNDG (Δ90 cyclinB) cloned in the pMT-EGFP-C vector (Invitrogen, Carlsbad, CA) were a gift from Helder Maiato and have been previously described (Afonso et al. ...
-
bioRxiv - Immunology 2022Quote: Popliteal LNs were harvested 3 days after infection with eGFP WT or ΔC15 ECTV and incubated at 37°C in media containing monensin (Invitrogen 00-4505-51) and PE labeled CD107a antibody (1:100 ...
-
bioRxiv - Cell Biology 2022Quote: ... or pHAGE-C’-EGFP-Gaw-IRES-Blast vectors using LR recombinase (Invitrogen). The pHAGE-N’-FLAG-HA-TBK1 cloning has been described previously (Sarraf et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR product and the pMT-EGFP-C vector (Invitrogen, Carlsbad, CA) were digested with the restriction enzymes KpnI and XmaI (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells grown on two 10-cm dishes were transfected with an expression vector for EGFP-BrD+AT1-3 or EGFP-BrD+AT1-3mut using Lipofectamine 2000 (Thermo Fisher Scientific). The next day ...
-
bioRxiv - Immunology 2024Quote: ... VHHs in lysate were detected via C-terminal eGFP domains with polyclonal rabbit anti-eGFP antibody (ThermoFisher; 1:5,000 in Wash Buffer) followed by HRP-conjugated goat anti-rabbit secondary antibody (SouthernBiotech ...
-
bioRxiv - Cell Biology 2024Quote: ... the MPS1 coding sequence was cloned in frame with N-terminal EGFP under the regulation of a metallothionein promoter in the pMT-EGFP-C vector (Invitrogen, Carlsbad, CA) as previously described (Conde et al. ...
-
bioRxiv - Genetics 2021Quote: ... to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher) to detect EGFP on the HSA21 ...
-
bioRxiv - Neuroscience 2024Quote: ... C - 3 days (Neurobasal media (Gibco) + N2 supplement (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... eGFP (A11122, Invitrogen), and His-tag (11965085001 ...
-
bioRxiv - Neuroscience 2024Quote: ... and eGFP (1:250, mouse anti-eGFP IgG2b, MA1-952, ThermoFisher) in the blocking solution at 4°C overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... or EGFP-FMRP and mCherry-DHX9-HD were grown at 37 °C (5% CO2) in DMEM (Gibco) supplemented with 10% FBS (Benchmark) ...
-
bioRxiv - Microbiology 2023Quote: ... and 40 cycles of PCR (95°C for 3 seconds, 60°C for 30 seconds) on a QuantStudio 3 (Applied Biosystems, MA).
-
bioRxiv - Immunology 2021Quote: ... anti-eGFP (Life Technologies) antibodies or anti-IAV antibodies (US Biological)overnight at 4°C ...
-
bioRxiv - Biophysics 2024Quote: ... expressing either enhanced green fluorescent protein (EGFP) alone, EGFP-Haspin (WT), or EGFP-Haspin (K569E, K759E, K761E, R772E) using Lipofectamine LTX transfection reagent (ThermoFisher, #15338500). Cells were transferred to 12-mm glass coverslips the day after and were fixed in MeOH at -20°C for 10 min on the third day ...
-
bioRxiv - Microbiology 2021Quote: ... anti-eGFP was used (eGFP Monoclonal Antibody, F56-6A1.2.3, Thermo Fisher, 1/1,000), associated with an anti-mouse secondary antibody (Goat antiMouse IgG (H+L ...
-
bioRxiv - Bioengineering 2024Quote: ... and mixed with 3 µ L of DMRIE-C (Invitrogen). After incubation at room temperature for 45 min ...
-
bioRxiv - Cell Biology 2021Quote: ... hRobo1-FL-3xHA(C)/pcDNA3 or hRobo1ΔCC0-3-3xHA(C)/pcDNA3 using Lipofectamine2000 (Thermo Fisher Scientific) and incubated for 24 hours and then sub-cultured into 12-well culture dishes and allowed to bed down overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... EGFP-hRNaseH1 or EGFP alone was cloned into pDONR-221 via Gateway cloning (Invitrogen) and then recombined into pLX-304 (Gift from David Root ...
-
Developmental effects of oxytocin neurons on social affiliation and processing of social informationbioRxiv - Neuroscience 2021Quote: ... rabbit anti-EGFP (A11122, ThermoFisher) or guinea pig anti-OXT (T-5021 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-eGFP (Invitrogen, #A-11122), Anti-HNF4α (Abcam ...
-
bioRxiv - Microbiology 2020Quote: ... a transfection of EGFP or EGFP-N was done using Lipofectamine 2000 (Thermo Fisher Scientific), following the instructions of the manufacturer ...
-
bioRxiv - Cell Biology 2020Quote: The PiggyBac EC-BioID-GFP and C-BioID-EGFP plasmids were transfected into Ecad-KO cells [47] using Lipofectamine2000 (Invitrogen) along with PiggyBac Transposase expression plasmid (System Biosciences ...
-
bioRxiv - Evolutionary Biology 2022Quote: We synthesized the Bowhead whale CDKN2CRTG protein with mouse codon usage (GeneScript) and directly cloned the synthesized gene into the pcDNA3.1-C-eGFP vector (Life Technologies), which added a C-terminal eGFP tag ...
-
bioRxiv - Cell Biology 2024Quote: ... and transfected with a total of 2 μg C-terminal EGFP tagged M2 tail using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer protocol after washing with 200 μL PBS and refreshing with 100 μL DMEM (ScienCell ...
-
bioRxiv - Plant Biology 2023Quote: ... the entry vector was subsequently recombined into the Gateway-compatible plant binary vectors pGWB505(48) for C-terminal fusion with EGFP (Enhanced Green Fluorescent Protein) through Gateway LR reaction (Invitrogen). The 1053 bp native promoter ...
-
bioRxiv - Cancer Biology 2021Quote: ... 72°C - 3 min) then cloned into Topo PCR 2.1 (Invitrogen) and sequenced ...
-
bioRxiv - Developmental Biology 2020Quote: ... the expression of eGFP was visualized using immunostaining with Anti-eGFP antibody (mouse, ThermoFisher, A-11120).
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were transduced with dual eGFP-luc (pMX-Rg) or GFP reporters (pLENTI6-eGFP, Invitrogen) as described in (39) ...
-
bioRxiv - Neuroscience 2024Quote: ... pcDNA3-EGFP-TAF1FL or pcDNA3-EGFP-TAF1d38 using LipofectamineTM 2000 (Invitrogen; 4 µL/µg of plasmid), while jetOPTIMUS transfection agent (Polyplus ...
-
bioRxiv - Cell Biology 2024Quote: SNAP-HA-EGFP (SNAP-EGFP) was cloned into the multiple cloning site of pcDNA5/FRT (Invitrogen) using the HindIII and NotI restriction sites ...
-
bioRxiv - Neuroscience 2021Quote: ... and eGFP (1:500, A11122, Invitrogen) were added and incubated with sections overnight at room temperature with 0.02% of sodium azide ...
-
bioRxiv - Molecular Biology 2022Quote: ... eGFP (Life Technologies Corporation Cat#TA150041), ETAA1 (Abcam Cat#ab122245) ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-EGFP (Thermo Fisher #G10362), rabbit anti-p-eIF2α S51 (Cell Signaling #9721) ...
-
bioRxiv - Biophysics 2021Quote: HEK293F cells grown in a 6-well plate were transiently transfected with CFTR constructs labelled with C-terminal eGFP tag using Lipofectamine 3000 (Thermo Fisher) in Opti-MEM (GIBCO ...
-
bioRxiv - Cell Biology 2024Quote: ... 6xHis-EGFP(A206K)-hsSynapsin1-Domain C (112-420) and 6xHis-EGFP(A206K)-hsSynapsin1-IDR (421-705) (Syn1-IDR) were expressed in Expi293F™ cells (ThermoFisher) for three days following induction ...
-
bioRxiv - Microbiology 2020Quote: ... at 4 °C for 3 h on a Labquake rotator (ThermoFisher Scientific). The beads were washed with 1 mL cold lysis/binding buffer four times at 300 g for 4 min at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: ... for 1h at 37°C and then with 3 µM DAPI (Invitrogen) for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and cel-miR-54-3p (C. elegans sequence: 3’-UACCCGUAAUCUUCAUAAUCCGAG-5’, Invitrogen) were added to each sample and used as external controls.
-
bioRxiv - Biophysics 2020Quote: ... (67)) or end-binding protein 1 (EB1)-EGFP (EB1/GFP-3; (68)) were cultured in Life Technologies Opti-MEM (Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: ... The 5’ homology arm-intron 21 and the 3’ cDNA MYH7-eGFP-SV40pA was joined by PCR and cloned into pJET1.2 (ThermoFisher, cat. no. K1231). The mPGK-PuroR-bGHpA fragment was isolated from p2attPC (Addgene 51547 ...
-
bioRxiv - Cell Biology 2020Quote: ... For transient overexpression (Fig 2 E-H, S2G) seipin tagged with C-terminal EGFP [34] was inserted into pcDNA5/FRT/TO (Thermo Fisher Scientific) through HindIII/NotI sites ...
-
bioRxiv - Neuroscience 2022Quote: ... brains infected with AAVrg-ef1a-DO-DIO-TdTomato-eGFP were incubated overnight at 4°C with rabbit anti-GFP (A-11122, Thermo Fisher Scientific) and rat anti-tdTomato (16D7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... C5AR1_OHu107216C_pcDNA3.1(+)-C-eGFP (pcDNA3.1/C5aR1-GFP) or empty vector were previously purchased from GenScripts and transfected with Lipofectamine 3000 (Thermo Fisher Scientific, L3000) according to the manufacturer’s instructions 6 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 293T human cells were seeded onto coverslips in a 6-well plate followed by transfection with pcDNA3.1-METTL8-EGFP or pcDNA3.1-METTL8ΔMTS-EGFP using Lipofectamine 3000 reagent (Thermo Fisher). For mitochondrial localization ...
-
bioRxiv - Molecular Biology 2023Quote: The human eGFP-Sun1 full length (eGFP-Sun1) gene was synthesized and cloned into the pcDNA3.1+ plasmid (Invitrogen) using NheI and XhoI restriction sites ...
-
bioRxiv - Cancer Biology 2024Quote: ... eGFP- or eGFP-IP3R3-transfected cells were resuspended in 1 µg/ml Propidium Iodide (PI, 11435392, Fisher Scientific). For mitochondrial membrane potential assay ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Cell Biology 2021Quote: ... The d1-eGFP plasmid was from Invitrogen, and constructed by cloning the d1-eGFP synthetic gene into a pcDNA3.3-TOPO vector backbone.