Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for Dengue Virus Serotype 2 DIII envelope protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... 2×50μL were deposited onto Whatman 903 Protein saver cards (Fisher Scientific). The DBS were dried in ambient conditions for 3 hours ...
-
bioRxiv - Molecular Biology 2020Quote: ... overnight followed by a 2-hour incubation with Protein G Dynabeads (Invitrogen). The beads were washed 3 times with buffer (10mM TRIS-HCl ...
-
bioRxiv - Microbiology 2022Quote: ... The proteins were transferred using iBlot™ 2 Transfer Stacks (Life Technologies) and the membrane was blocked with 5% dried skimmed milk (Marvel) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dynabeads with precipitated proteins were washed 3 times with DynaMag-2 (Invitrogen) and eluted with LDS buffer (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... approximately 2 mg of lysate and 25uL of Protein G Dynabeads (ThermoFisher) were incubated with 1 μg of the indicated antibody or control IgG overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... BA.2 RBD proteins (1μg/ml) were loaded in casein (Thermo Scientific) on 96-well Ni-NTA plates (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... and CCR5: rabbit anti-SARS-CoV-2 S1 protein (PA5-81795; ThermoFisher) at 1:2,500 ...
-
bioRxiv - Immunology 2024Quote: ... Immunoprecipitated proteins were pulled down using DynaMag-2 Magnet (Thermo Fisher Scientific) and washed 2 times with IP buffer with 0.1% NP-40 ...
-
bioRxiv - Molecular Biology 2020Quote: ... proteins were dialysed in PBS for 2 x 2 hours using Slide-A-Lyzer™ Dialysis Cassettes (Thermo Fisher). Protein aliquots were frozen and stored at −80°C until use.
-
bioRxiv - Cell Biology 2021Quote: ... and 2+2 μg of plasmid DNA encoding the proteins were mixed in Opti-MEM™ (Thermo Fisher Scientific) and applied onto the cells in a single well ...
-
bioRxiv - Microbiology 2020Quote: ... Cell envelopes were stained by adding 5 µL of 1 mg/mL FM™ 4-64FX (Thermo Fisher Scientific) and non-viable cells stained with 1 µL of the LIVE/DEAD™ cell dye (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA plasmids were co-transfected into HEK293TD cells along with packaging (Δ8.9) and envelope (VSVG) expression plasmids using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Immunology 2019Quote: ... 3 μg guide RNA plasmid was cotranfected into 5 × 106 HEK293T cells with 3 μmg psPAX2 packaging vector and 1.5 μg pMD2.G VSV-G envelope vector using lipofectamine 2000 (Invitrogen). Supernatants were harvested over 72 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2.16 μg of the vector expressing the VSV-G envelope glycoprotein (pMD2.G) were mixed with OptiMEM (Gibco) to a final volume of 400 μl ...
-
bioRxiv - Bioengineering 2022Quote: ... packaging coding vector (pCMVdR8.74) and envelope coding vector (pMD2.G)) was diluted in 250 µL Opti-MEM (Invitrogen, Germany) and 11.25 µL of polyethyleneimine (1 mg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA plasmids were co-transfected into HEK293TD cells along with packaging (Δ8.9) and envelope (VSVG) expression plasmids using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 µg packaging plasmid (psPAX2) and 2.5 µg envelope plasmid (pMD2.G) using Lipofectamine 2000 in OptiMEM (ThermoFisher Scientific). After 6-hr incubation of Lipofectamine/DNA mixture in OptiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... and envelope (pMD2.G; 0.5 µg) plasmids using either FuGENE 6 or Lipofectamine 3000 transfection reagent (both from Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.84 μg of pCMV-VSV-G envelope plasmid, 5.67 μg of pCMV dR8.2 dvpr packaging plasmid in OptiMEM medium, Gibco #31985062) and 1 ml of premix 2 (42.5 μl of Lipofectamine LTX ...
-
bioRxiv - Molecular Biology 2020Quote: ... The suspension was incubated at 25°C for an additional 2 hr with Protein G SepharoseTM 4 Fast Flow or DynabeadsTM Protein G (Invitrogen), pre-blocked with 1 mg/ml BSA and 0.25 mg/ml Salmon Sperm DNA ...
-
bioRxiv - Cell Biology 2022Quote: Surface proteins on Caco-2 cells were biotinylated using Pierce Cell Surface protein biotinylation and Isolation Kit (Thermo Scientific, A44390) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 viral nucleocapsid protein (NP) was detected using the anti-NP protein antibody (Cat. # PA5-81794, Thermo Fisher) diluted 1:10000 in 0.1% tween-20/1%BSA/PBS solution as a primary antibody ...
-
bioRxiv - Biochemistry 2022Quote: ... The Z-scores for reactivity of SARS CoV-2 proteins to each human protein was determined by using ProtoArray Prospector v 5.2 software (Invitrogen, Thermo Fisher).
-
bioRxiv - Immunology 2023Quote: ... 2% SDS and 10% Glycerol) and protein concentration was measured using Pierce™ BCA Protein Assay kit (Thermo-Fisher Scientific). 20µg of protein was resuspended with SDS-loading dye (50% β-Mercaptoethanol and 0.02% Bromphenolblue) ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibody–protein complexes were recovered during 2 h incubation at 4°C with protein A/G magnetic beads (Thermo Scientific), followed by duplicate washes of 15 min with low-salt wash buffer (0.1% SDS ...
-
bioRxiv - Microbiology 2021Quote: ... virus stocks were prepared in serum-free VP-SF media (Invitrogen). Viruses were harvested before CPE development ...
-
bioRxiv - Cell Biology 2021Quote: ... The virus packaging was performed in HEK293FT cells (Thermo Fisher Scientific) based on a calcium precipitation method using pUMVC and pCMV-VSV-G vectors (37 ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems). According to the manufacturer’s instruction (QIAamp Viral RNA mini kit (Qiagen)) ...
-
bioRxiv - Microbiology 2022Quote: ... using TaqMan Fast Virus 1-Step Master Mix chemistry (Applied Biosystems). SARS-CoV-2 genomic RNA was amplified and detected using forward (5’- CGTGTAGTCTTTAATGGTGTTTCC-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... cells and purified virus particles were lysed with RIPA (ThermoFisher Scientific) buffer supplemented with complete protease inhibitor cocktail (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... TaqMan™ Fast Virus 1-Step Master Mix (4444432, Life Technologies) was used for one-step RT-qPCR and TaqMan Fast Advanced Master Mix (4444556 ...
-
bioRxiv - Microbiology 2020Quote: ... Virus stocks were treated with 40 U/mL DNase I (Invitrogen) for 1 hr at 37°C before they were used to infect cells for 2 hr at an MOI of 0.5-2 ...
-
bioRxiv - Physiology 2022Quote: ... and 200 U of Moloney murine leukemia virus reverse transcriptase (Invitrogen) in a final reaction volume of 20 μL (Evans-Molina et al. ...
-
bioRxiv - Microbiology 2020Quote: ... using TaqMan Fast Virus 1-Step Master Mix chemistry (Applied Biosystems). SARS-CoV-2 N gene RNA was amplified using forward (5’-GACCCCAAAATCAGCGAAAT ...
-
bioRxiv - Genetics 2020Quote: ... Cells were then transduced using CytoTune-iPS 2.0 Sendai virus (Invitrogen) as outlined in the supplier’s protocol at an MOI of 5:5:3 (KOS [Klf4 ...
-
bioRxiv - Microbiology 2021Quote: Virus replication assays were performed in RPMI 1640 (Gibco 11875-093) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of TaqMan Fast Virus 1-Step Master Mix (ThermoFisher), and 9 μl of molecular-grade water per reaction ...
-
bioRxiv - Immunology 2023Quote: ... TaqMan Fast Virus 1-Step Master Mix (ThermoFisher, Cat No. 5555532) and a commercially prepared RNAse P primer/probe combination (IDT ...
-
bioRxiv - Immunology 2023Quote: ... Taqman Fast Virus 1-step kit (Thermo Fisher; catalog number 4444434) with oligos and probe specific to the N gene of SARS-CoV2 was used for SARS-CoV-2 RNA detection according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... virus inoculum was exchanged with serum-free MEM (Gibco, Life Technologies) containing 0.75% carboxymethylcellulose (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... virus inoculum was exchanged with serum-free MEM (Gibco, Life Technologies) containing 0.75% carboxymethylcellulose (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... dNTP and Moloney murine leukemia virus (M-MLV) reverse transcriptase (Invitrogen) were used to synthesize cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: Virus particles were fixed in 1 % glutaraldehyde (Cat# 233281000, Thermo Scientific). A 4 µL aliquot of sample was adsorbed onto holey carbon-coated grid (Lacey ...
-
bioRxiv - Microbiology 2022Quote: The monoclonal antibodies SARS-CoV-1/SARS-CoV-2 Spike Protein S2 (1A9) and SARS-CoV-1/SARS-CoV-2 Nucleocapsid (6H3) were purchased from ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... 300 μg lysates were pre-cleared with 2 μl Protein A Dynabeads (Invitrogen) for 1 h at 4 °C ...
-
bioRxiv - Genetics 2020Quote: ... Protein was transferred to a PVDF membrane using the iBlot 2 (Life Technologies). The membrane was blocked with 5% milk in TBST for 1 h at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... was coupled for 2-4h to 11µl of Protein G Dynabeads (Thermo Scientific) and used for overnight chromatin immunoprecipitation in IP buffer (1% Triton X-100 ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were reduced with 5 mM Tris(2-carboxyethyl) phosphine hydrochloride (Thermo Fisher) for 30 min and alkylated with 10 mM iodoacetamide (Sigma Aldrich ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM MgCl2) and 4 μM of the phosphobinding protein (PBP) (Life Technologies) to detect the inorganic phosphate (Pi ...